v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LRRC52 antisense RNA 1 (LRRC52-AS1) URS00008E3971_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LRRC52-AS1: LRRC52-AS1 is a long non-coding RNA (lncRNA) that has been identified as one of the six sulfatide-related lncRNAs associated with prognosis in thyroid cancer [PMC9929346]. LRRC52-AS1, along with other lncRNAs such as LINC02082 and UNC5B-AS1, can be used to differentiate between benign and malignant tumors in thyroid nodules [PMC9483125]. The expression levels of LRRC52-AS1, LINC02082, and UNC5B-AS1 were significantly increased in malignant nodules compared to benign nodules and paired normal thyroid tissues [PMC9483125]. The diagnostic potential of LRRC52-AS1 was confirmed through the evaluation of expression levels in samples collected from patients who underwent fine needle aspiration (FNA) on thyroid nodules [PMC9483125]. When two or more of the LRRC52-AS1, LINC02082, and UNC5B-AS1 lncRNAs were above the cut-off value, a high sensitivity (88.9%) and specificity (100.0%) for diagnosing papillary thyroid carcinoma (PTC) using FNA samples were achieved [PMC9483125]. LRRC52-AS1 has also been associated with clinical progression and regulation of cell migration and invasion in PTC [PMC9483125]. Interestingly, the expression levels of LRRC52-AS1, LINC02082, and UNC5B-AS1 were not elevated in non-invasive encapsulated follicular thyroid neoplasm with papillary-like nuclear feature (NIFTP) [PMC9483125]. Overall, LRRC52-AS1 shows promise as a diagnostic marker for PTC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCCCGUCACCUUGCAACGGAUGGUGUAGGGCUUGCCGAUCUUGUUCCCCUAGUAACCUCUGCGCAUGGGGACAAUGGAGAGCUAGGCCAGGAUGAUGGCCCUGUGGAUGGCAGUGGCCACCUCCUUGGAGCACUUAACACCCAGACCGACGUGACCGUUGUAGCCCGCAAUGGCCACAAACGCCUUGAACCUGGUUCGCUGGCCGGCUCCGGUCUGCUUCUGCACCGGCAUAAUCUUCAAAACCUAGGCCUCGAGAGAGGCCCCCCAGGAAAAAAUCAAUGAUCUCAGAUUCCGUGAUGGGCAGGGAGAAGAGACAGAUCUCCUCCAGGGAAGUGAUCUUCAUGUGCUUGACCAGGCAGCCCAGCUUGCUGACGGGCAUCCACUCCUUAUCCUUGGCCUUGCCUCCGCGAGCUCCGUGGCUUCGGCCCCAGCCUGGUCCACGGCAGUGACCCCGGCCUCGGAUGCCACUGCCGAAACCUCCACGGAAGCCACCAUGGUUCCCCAUCCCAGGGCCCCGGGGCCUCCGGGACUCCCCCCGCAACCCAAUGCCGGCUGCGCCGGCGUCAUCCGCCAUUUGGUGUUUUCUCGGAGAAGAAGCUACAUGUGGAAUAUAUUAACGCAACAAAUUGUGCGUACUUGCUAGACAUUAGGCAUGAUAGCAAGUGCUAGGGUUACAAAGUAUUGCUUUUUGGGGAACCCAUGGUUGUUGGGGAGAAACCAGAAGAUCAGUCAUCACAGUGCGGCAAGAUCAGACUUGUGGUUUGUUCAGGUUCUGGGAGCCGUCACUGCAGUGAGAAUGGACCCCACAAUGUCUCAUAAGGGGAUCUGCAAGGCAGCCCUAAAUUCCAAGCAGGACAUGUAACUCCUCAAUGGACAAAUGGACACUGGACCCUGGUUGAAGGAACCUGUUGUUCUUAUGGUGGAGGGCAGAAACCCAAGAGGGCUGGAGCCAAUCCAUAACUCAGGCACGUGGCCACAUCUAACAGCAAGGGAGUCUGGAAAACACAGUUCAGCUGUGUGAAGGAUAUUUAUAAACAUUUAGCAAGAUCCAAAGGAAUGGACCAUAGCACAGCCCUGUUUUCUUUAGACGCUGACUCCUGCUGUCUACCAGAUCCUCGUGGUACAAUGACUGGUGUAGACUGGCUUGUUGAAGUCACUCUCUGGAUCUGAGCAACGCUGGCUGAGCCGUGAUGAAGUAUUCCUAUCCAUCCACUAUGCUUCACAGUGGGAAUCUCUCACUGUUCAUCACCGCUGCCCUAGCAGCCGCAGGGAUUCUUCACCCAUGGUUGCUUAGGUUUAUAAGCAAGGAAGCUGAAUGAAGUCCCUUUCCUCUCUGGAUGAGCCCCUGGGUUUCUGGAAGAGUCUUAAAAUCACCCCUAAAUGGCUUCCAAGCACUGAAGCCCGAGAUGUUAGCUGGCCUGUGUGAGGCCUUGAGACAGAAUGCCACAGCCACACCCCAAGGAUGCUGAAGGGGAUUUCCCUCCUCUGUGGUUUUUCUCCUUUCUUCCCGCAGCACUCCUCCUACGUGCUAACAUCUUCUAGUCAAACAACUCUCCUUUUCAAAGGGACCAGGCACAGUUUCUGCUUAUCCCUGAGUAGCAGUGUUCAGUUUCCUGCCAGCCUGUGGAGUUUUUCAAACAAGCCAAUCACCUCCUCCUGUGGGAACUGAGAAGCACCCCACCCUCUCGAUACUACAAAGCCCCUGCUUGUUCCCUAGUGCAACUCCCAUGUGGUCCUGUGGAGCAUAUGGUAUCUUCCUCUUCUGGGCAGUGAGCAUAUGUGACUAAUAAACUAUCUAUCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications