v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TTC3 antisense RNA 1 (TTC3-AS1) URS00008BAEC8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTC3-AS1: TTC3-AS1 is an oncogenic long non-coding RNA (lncRNA) that is upregulated in gastric cancer (GC) [PMC8260299]. It has been found that POU2F1, a transcription activator, can directly bind to the promoter region of TTC3-AS1 and activate its transcription [PMC8260299]. Knockdown of TTC3-AS1 can reverse the protumor effects of POU2F1 in GC cells and inhibit tumor growth in vivo [PMC8260299]. The expression of TTC3-AS1 is significantly enhanced by overexpression of POU2F1, and there is a direct interaction between POU2F1 and the promoter region of TTC3-AS1 [PMC8260299]. Survival analysis has shown that high expression of POU2F1 and TTC3-AS1 predicts poor prognosis in GC patients [PMC8260299]. The subcellular distribution analysis has revealed that TTC3-AS1 is mainly located in the cytoplasm but also present in the cell nucleus, suggesting its involvement in posttranscriptional regulation [PMC8260299]. Function analysis has demonstrated that lncRNA TTC3-AS1 mediates the protumor function of POU2F1 by promoting GC cell viability, migration, invasion, and tumor growth [PMC8260299]. The binding sites for POU2F1 on the TTC3-AS1 promoter have been identified through bioinformatic analysis and confirmed by dual-luciferase reporter assay [PMC8260299]. In addition to GC, upregulation of lncRNA TTC3-AS1 has also been observed in various types of cancers [PMC8260299][PMC9101833][PMC9482270]. It has been found to be associated with poor prognosis in GC patients as well as shorter survival time when highly expressed [PMC8260299][PMC9482270].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUCUGGGAGACUUCCAACUGGGAAUCUCCCGCUGAGGCCACACCUCUAGAUUAGGUUAGUGGCCCCUGAUCCACGCCGCUCCAGCAUUCUGCCAUGAGAAACCUCACUCUGCUGCAGCUUUAUCUUCUAAAUGACGUGCUGAGAACACCCACGAAACUGCAAUACCGGCUAAUCAGCCCCAGCUUCUUCAGAAAGGCUUCUGCUUGUGACUCCAUGAUCUGUAGCUUAUACACUUCACUCUCCUUCCAGUUUUCAAGUACGGAUACCUGCCAGUAGAUCAGAAGACAUAUGAGUAUUUUACAAAUGACAGCCUGAAACUAUUUUAAAGGUUAAAACUUAAACAUUCAAACCACUUUCCCAUUUCUCCUUAAAUGAAGCAUGACAGAAUCAUCAGAACUUGAUUGUAUCAUAGGUGAACAUGAAUUAGACUUUGAGAUUUGAAAACAGAACAAAAUGACAUCACAAAUGCAUACCUUCCAUGAUCCUUUUUGCAGAUAUGAAUAACUGUACAUGGCUUUCUGCUUAAGCUAUAUAUAAGCACAGAGCCAGGUUAACUGCAUGUGUACACGAGUGUGCAUUACCUAUGGUCCUGCAGCAGAAUAACCCUUAAUAAAGGCUGCAUCCUCUGCAAGUUUAGAAAAGCCUCAGAGAAGCUGUUCUCGGCAAGGGCAUCAAAAGCUUCGGGGUAUGCUUUUAAGAUUUUAGACUCUCUGUGGCUUCCCCACAAACCAACUGGCCAUUUUUGUGAGAAUCACUGCAGGAAAUGUAAAAUGGCCUCAUGGUCCAAAUGAUCCAUUAAAUAGCCUUUUAAUCCAGGUGUCAGUAAACUUGACAGGGCCCACCAGGCAAACCUGCUUACCAAACGGUGGUGUGAAUUAAACAAGCUCAGGAAUACGGAUGCUGGUGUAGGACCCAAAAAGUAUUCAUACUUUGGCUCUUUUUCCUUUCCUGUCCUUAGAAGCAGGUGCAUAGUCAAUUCUUAAUUGAAAAGCCUAAUGUUUGCAGACUGUAUAAACUAAGUCUUUUCUUACUUUACCAGAAUAAUCACAGACACAUAUGCCAAUAAAUAUCAUUUGUUUCUCAGCUACAGAAACAUAGAGAAUCAUGUUUCUGGAACUAAAUAAAAUACAGCCAGAUGUCAUAAUUUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications