v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) FOXO induced long non-coding RNA 1 (FILNC1) URS00008B354E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FILNC1: FILNC1 is a long non-coding RNA (lncRNA) that is highly expressed in renal cell carcinoma (RCC) and its potential as a biomarker for clinical RCC diagnosis requires further investigation [PMC10034124]. Under glucose deprivation, FILNC1 is upregulated by the transcription factor FOXO and interacts with AU-binding factor 1 (AUF1) [PMC9138696]. This interaction prevents AUF1 from binding to the MYC/c-Myc promoter, resulting in a reduction in c-Myc expression [PMC9138696]. Low levels of FILNC1 in renal tumor cells are associated with a negative prognosis [PMC8389562]. A comprehensive analysis identified 88 potential binding proteins of FILNC1, including AUF1 [PMC5627275]. However, the impact of FILNC1 knockdown on the activity or flux of the pentose phosphate pathway remains unclear, as it did not affect the expression levels of key genes involved in this pathway [PMC5627275]. To further investigate this, c-Myc was knocked down by siRNA in FILNC1-deficient cells under glucose starvation conditions [PMC5627275].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAUUUGCAGAAAGAGCCAACAACUCCUACAGAUGAUGACAGUUCUCAUUCUCCAGCAGCAAAUAAUCCCAAAGGAGGUAAACAUCUAAAAGAAAGGAAUGAAAACAGGUUUUAUUUAUAAAUGCCUCACUGUUGGAACCUGCAUGAAUGAAAGCUGAAUCUCAAAGAUCAGACACGUUGGACUUGGAAUAAUGUCCAUGUUAUGAUUCCAAUCUGUGCCUAAAUCUGAACCACUCAGUUCUUCAUGCUUGUUGGAAUCCUCCUAAAAUUGGAAUUUCCUGGGAGAUAUCCAGUACUUUUUGGGCUGUAAACAGCAAAACAAACAGCCUUUCUUGUAAUAUGCUACGUCUAGUGCUAACUGAAUUCAAGAAGUUUAUGAGUGUGGGGAAAGUAACUUGAUGUCUUUGCAAACUUACAAAUUUGCUUCAGUUUAAAUUUUGACCAAAAAUUCAUCUCAGGAAUAUGUUUUGGAAUAAUUCUUUGCUAUUAGUUAUAAAUGUGACAAAUAUCGUUUAAACAAUAAAAUAUUAUUUUAUACAACAAAUUAUGGCAACAAAUUCCUUGUAGUGAUAGAUUUUUUAAAAUCUUUAAAUCAUAGAUAGGGAUUUAUUAUGCUCCAUGUCAAUUAUAUGCAUGUUUGUGUGUAUAUGUGUGUAUAUGUGUGUGUAUAUAUAUUUCACUUAAUCUCUGAGAACAGUCUGAAUUUUUAUGUUUCUCUAUUGUAUAUAAUUGAAAAACAUAAGACAAAGAAAUCACUUAUUAGUACGUUGAUAGAUAAACGUGCUUGAUGCCAAAUAUAGACACACAAAAUACACUUAAUUCUUCUGUAAGAACUCUUAAACAUCUAUGAGAAACAUCUUAUCAAAUUGAUUUCCCCCUUUCUCCUUAGUAAAAAAAUCCUGACGUUUUUAGGUUGACACAAUGCCACUCAGCUAAACAAUGACAUUUCCCAGACUCCUUUGUGUUUAAGUGUGGCCGUAUAACUAGGUUGUGCCCAAAGACAAUUAAGUAUAACUGUUGGGUAUAAUUUUUCUGAAAAGUCUCCUUAAAAAUAUGACGGUUUUUCCUUGCUUUCUUUUUUUCCUUGUUAUUUAGAGUACGAGUAUUGUAUCUGUAGCUCCAGCAGCCAUCUUGGACCAGAAUAUGAUGGUCUGGAGAAUGUAAGCCAUGUGCAGAAUGAUACUUACAGACAAGGGACUGUGUACUUCAUUGAACCGUAAAGCUGCCAUAGUUGCCUUGGAUACUCUCCUUGUGGACACCUUUUAUGUGCAAGAAAAAUAAACUAUCUUGUUUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications