Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens C/D snoRNA (SNORD103B) secondary structure diagram

Homo sapiens C/D snoRNA (SNORD103B) URS000083292E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORD103B: SNORD103B is a small nucleolar RNA (snoRNA) that is 100% identical to SNORD103B, as shown in Supplementary Figure S14 [PMC6901076]. When considering read pairs aligning to these snoRNAs, 96% of them map equally well to both SNORD103B and SNORD103B and are discarded as multimapped reads [PMC6901076]. CoCo, a computational tool, distributed the 2314 multimapped read pairs proportionally to the 87 uniquely aligned read pairs for SNORD103B and SNORD103B [PMC6901076]. In addition to SNORD103B, other snoRNAs identified in the study include bovine small nucleolar RNA C/D (SNORDs) and bovine small nucleolar RNA H/ACA (SNORA) [PMC7072903]. RT-qPCR was performed to confirm the presence of SNORA80E, SNORD103B, SNORD59A, and SNORD104 in a subset of breast tissue samples [PMC9803687]. The expression levels of these genes measured by RT-qPCR correlated significantly with the respective small RNA-seq measurements [PMC9803687]. The reverse transcription for RT-qPCR was performed using specific RT primers obtained from the Custom TaqMan Small RNA Assays for each gene [PMC9803687]. qPCR was then performed using TaqMan Small RNA Assays and TaqMan Universal PCR Master Mix II no UNG according to manufacturers' instructions [PMC9803687].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUGUCUGGCAAUGAUGACCCACUUGCCCUCACUGAGAACAAAGUUCGGUAAUGAGAAUCUUUGUUAAUGGACUCAAGUUCUGAGCCAGACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications