Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA, muscle differentiation 1 (LINCMD1) URS00008121C0_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINCMD1: LINCMD1 is a well-studied long intergenic non-coding RNA (lncRNA) that is expressed in mice during myogenesis, along with Mir206/133b [PMC5137429]. Among four lncRNAs, including LINCMD1, KCNQ1OT1 showed a gradual increase in expression levels with an increase in Ang-II concentration [PMC7578479]. LINCMD1 and HuR are both involved in muscle differentiation and are under the inhibitory control of miR-133 [PMC6798851]. LINCMD1 acts as a decoy for microRNA targets produced from the same locus as LINCMD1 [PMC3788346]. It regulates the timing of myoblast differentiation and acts as an endogenous sponge for miR-133, playing dual roles in muscle differentiation and regeneration [PMC6250799] [PMC8483262]. In the cytoplasm, lncRNAs like LINCMD1 modulate mRNA stability by duplexing with 3' UTRs [PMC3929073]. LINCMD1 is a muscle-specific lncRNA that acts as a competitive endogenous RNA (ceRNA) for miR-133 and miR-135, regulating the expression of MAML1 and MEF2C during muscle differentiation [PMC6351848]. In a study on high-intensity interval training (HIIT), 204 lncRNAs were differentially expressed after 12 weeks of HIIT, including LINCMD1, which is related to muscle function [PMC7533564]. Under starvation conditions, the expression levels of several lncRNAs including LINCMD were significantly different compared to control conditions, suggesting their involvement in skeletal muscle differentiation and atrophy under starvation conditions [PMC6798001].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCACCUUCAACUAAACUCCAUUCUGUGCUGCCCUUUGGAACACCCACUCAAUGGCCUUCACACUCCAUGUCCUACUUGGGAGGACAUGUGAUCUCAACAGCACUCACAAAUGAAGGCUUUCCAGACAGGAUAUUGAAGAUGGGAGGUGUGAGCUGUGGGAGAGAGCUGACUAAGAAGAAGAAACUCCCCAGAAAGGUGGCCUGCCAGUCUUCACGAUGUAUGGGAGCAGGUGGGAAAAGAGCUGCAAGUGUUUGCACUUCAUCAUUGAAAUUGUUGAAACUGCUGAUCAGGAAACACAGAAUGAGUUUAACCAGCGAUGCCAACUUCUGCAAGAUGGACUCCAGCUUGGGAGCUCUGUAUGGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications