Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1173 (LINC01173) URS0000811C76_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01173: LINC01173, a long non-coding RNA (lncRNA), has been implicated in TSH adenomas and type 2 diabetes mellitus (T2DM) [PMC7652879]. Increased expression of LINC01173, along with alterations in vitamin D levels and smoking habits, may contribute to the severity and pathogenesis of T2DM [PMC9397532]. Vitamin D insufficiency has long been suspected as a risk factor for diabetes [PMC9397532]. T2DM cases with GAD autoantibody showed higher expression of LINC01173 compared to cases without autoantibody [PMC9397532]. T2DM cases with hypertension, impaired wound healing, and blurred vision also exhibited higher expression of LINC01173 [PMC9397532]. A study among Saudi T2DM cases found significantly higher expression of LINC01173 compared to controls [PMC9397532]. Smoking was associated with increased LINC01173 expression in T2DM cases [PMC9397532]. The association between LINC01173 and vitamin D levels was also analyzed, revealing higher expression in vitamin D-deficient cases compared to insufficient and sufficient levels [PMC9397532]. The study concluded that the risk of T2DM may be associated with higher expression of LINC01173, altered vitamin D levels, and smoking habits [PMC9397532].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAGUGAAGGCAGACCACAGGCUGGCAAAUGGAAAUGCAUGAUGCUUCCUAAGGCCUAGGCUCAGACCUGGCAACUGUCAAUUCCACUUUCCUCAUCUUAUAAAAUUCUGGUUCUCAAUGACACCAGCAUCAUUACUGAUUUGCUUUCUACUCACACACAAAUAGCCUCCAAAUAAGAAUGCCAACACUAUCACCAAAAAGGAAAAAUUAUCUUCGUUUCCCCAAGGCCUGCAGCUUUCAUAAGAAGGCAGGAGUUUUUGGAGGAGAGCGUCGUGUUCGUCUGUCUGUAGACCCUGAGACACUGAUUUACAGCAAGACUCACGGUGACAAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications