Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LHX5 antisense RNA 1 (LHX5-AS1) URS00007E4C48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LHX5-AS1: LHX5-AS1 is a previously uncharacterized gene cluster that has been identified in a subset of individuals in a cohort study [PMC8012207]. Experimental validation of repeat lengths in LHX5-AS1 using PCR amplification and Sanger sequencing confirmed the predictions made by ExpansionHunter [PMC7844047]. The analysis of the cohort revealed 29 populations characterized by specific genes, including LHX5-AS1, which was found to be strongly enriched at early timepoints and expressed broadly at CS13 but restricted to the developing cortical plate by CS14 and CS16 [PMC8012207]. The expression pattern of LHX5-AS1 RNA was found to be consistent with that of LHX5 protein [PMC8012207]. Additionally, CpG sites related to long noncoding RNA or antisense genes, including LHX5-AS1, were identified and found to be associated with various cell developmental and proliferation pathways in different types of cancer [PMC5687331]. These findings suggest that LHX5-AS1 may play a role in early development and potentially have implications in cancer development. Further research is needed to fully understand the function and significance of LHX5-AS1.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCGUUGCUGUCCGGACAGAGCAAAAAAAACAAGGCAUCAGUAUUGUUGAGUAUUAGCUUGUACCUGGUUCGGAGGCUAAGUUUGCCGGAGAAGGCAGGGGUGAGCCACGGUGGCUGCCCGGCUGUGCACCGGCGCCGGAGUUUGGACCAAGACAAAGACAGGAGCUGUCCGCGGUGCUGAAUCGGCGGCGCCGUCGCCGGAGCAAGGGGGCUUCUGUAACCAGCCCUCUGCUCAUUUACUCCCCAUCCUUCUAGCUCCCCUUCGCUCUGUGACUCUUGCCUUCCCCUGAAUUUAUUUCCCUUUUGGGGGACUCACCUUAGAACCUGCGCCCUGUACACAGGUGUAUAUACAUAUAUCAAAGAACAAAACGAUUGAUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications