v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TBX2 antisense RNA 1 (TBX2-AS1) URS00007E4A0B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TBX2-AS1: TBX2-AS1 is a long non-coding RNA (lncRNA) that is tightly co-expressed with TBX2 and is associated with neuroblastoma [PMC8394133]. In a study, TBX2-AS1 was identified as one of the top ten most important lncRNAs associated with the RF model [PMC9989175]. Furthermore, TBX2-AS1 was found to be upregulated in tumor samples compared to normal samples in neuroblastoma [PMC8394133]. The enrichment of eQTL signals for TBX2-AS1 suggests that variants at this locus may be associated with pulse pressure during cardiac development [PMC9975214]. In the context of renal cell carcinoma (RCC), a risk score was established using a 9-lncRNA signature, and TBX2-AS1 was one of the lncRNAs included in the risk score formula [PMC8806408]. In osteosarcoma, TBX2-AS1 was identified as one of the four important ARLncs used to construct an effective four-lncRNA signature for risk prediction [PMC10076677]. The expression level of TBX2-AS1 varied in different risk subgroups, with lower expression observed in the high-risk group for osteosarcoma [PMC10076677].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGCUGCCUGCGCCGGACUGGAGAGCGCGGAGGGCCGACCUGACCCGCCGAAAGGGCCUGAGGCGAGGGGAGCCCGGGUCCCGGGGCCUUGGGGAAGGACCCGCAGCCGCACGCCGGCCCCAAGUGCAAAGCAUUGACACGACCCCGAGCGGAGAGGGGGCGCCCUCCUUCUCCCGCGCCCAGAGGCCCGGCCGCUCUGGCCCGAGCCCCAGCCUGGCCUCCGACCCAGCUCCGGGUCGUGGCGCCGCCUGGGGGUCCCUGCGCCCCGGAAAGAGACAGCAGGCACUGGAAAGCGAGGCCGGUGGGCGGGCGAGUCGGGAGGCUCGGGCGGCCGAGGUCCGGGAGCGGAUCCCAGGUGGCGGGAGCUGGUGAGUGGAGCCAUGGCCGAGCCCUGCUGGGGCCGGCGCGGGCGGGAGCGGGACGCGGCCUUGCGCUGGGGAAACGCGGGGACCCCCUACCCGCGCCCGCCUUCACCGGAAGACUCGGAAGGAACCUGGAGUUCUCCGCAGGCCCGGGCCCCGCCCUGAGCUUUCCAGCGGCCGGGAGGAGCGGAUCCUCGGGGCCAGGAAGGUGCCCUGGCAGGAGGGACUGGCUUAUGCCACCCUGUGCAGGAUCGUCUUCUCAGCUUACAGAGCCUAGUGUGAUUCAACAACCCUCCAUCUCUGCCCCCAACAUGCCCAACUGAUCUGGUGGAGGGAACUGAAGAUGAAGGCCUCUCAGGCACCAUGGAUGGGAUGGGUGUGUGUGAAGGGGGCAGGGUCCCCAGGAGCUGCCCCAGGUCUGGCUGGACAGUUGCACGGGAAGUCCUGUUUGUGAACUCAACGUUUCCACGGCUUUUCCAUUAAACUUUACCCCAAAUCAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications