Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) DISC1 intronic transcript 1 (DISC1-IT1) URS00007E4964_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

DISC1-IT1: DISC1-IT1 is a non-coding RNA that participates in diverse cellular processes, including GTP hydrolysis, folate pool regulation, voltage-gated potassium channel activity, structural cellular components, steroid synthesis, chromatin regulation, non-coding RNAs, and transcription regulation [PMC9247704]. In a study on lung adenocarcinoma (LUAD) prognosis, DISC1-IT1 was identified as one of the potential biomarkers [PMC7523091]. However, there is a lack of relevant studies on the function of DISC1-IT1 in cancer [PMC7523091]. In another study on Henoch-Schönlein purpura nephritis (HSPN), the expression of DISC1-IT1 was found to be dramatically downregulated in blood samples compared to normal blood samples [PMC9636465]. The downregulation of DISC1-IT1 may serve as a potential indicator for HSPN [PMC9636465]. Additionally, in the same study on HSPN patients' blood samples compared to normal blood samples, the downregulation of NEAT1 and PVT1 was also observed [PMC9636465]. NEAT1 and PVTI may also be potential indicators for HSPN [PMC9636465]. The expression levels of other lncRNAs such as SNHG3 and LINC00152 were significantly upregulated in HSPN patients' blood samples compared to normal blood samples [PMC9636465].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACAACCACCAGAAGCUGGGAGAGAGGCACGGAAAAGAUUCUCCCUCAGAGCCUCAGAAGGAACCCACUGGACUAACACCUUGACUUUGGAUUUCUGGCUGCUGGGACAAUGACGGACUGACAUGUUCCUCCGGCUCUGCCACACCCAUCAGAUGGCAGGUGGGGAGCAGAUUAAGACAUGGGCAUUCGCAGGGUGCACAGAACGCUGGCUUACAAACACCUCCUCUCAUAGGCAUGCAGGGUCUCGCUGUGUCACAGAAGCUGGAAUGCAGUGAUGCAAUCUUGGCUCACUGCAACCUCCACGUCCUGGGUUCAAGCUAUUCUCCUACCUCAGCUUCCUGAGUAGCUGGGACUAUGGACAUGUGCCACUACAGCUGGAUAAUUUUUGUAUUUUUAGUAGAGAUGGGGUUUCAGCAUGUUGACCAGGCUGGUGUUGAACUCCUGACCUCAGGAGCACCCAGAUUCAAAAAGCAAGUUCUUAGAGACCUACAAAGCGGCUUAGACUCCCACACAAUAAUAGUGGGAGAUUUUAACACCCCACUGUCAAUAUUAGAAAGAUCAACGAGACAGAAAAUUAACAAGGAUAUUCAGGACUUGAACUCAGCUCUGGACUAAGCGGACCUAAUAGACAUCUACAGAGCUCUCCACCCCAUCACAAACUUAAUCCAUCACAUAAAUACCAAAUACAUUCUUCUCAGCACCUCAUCACACUUAUUCUAAAAUUGACCACAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications