Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) UBE2Q1 antisense RNA 1 (UBE2Q1-AS1) URS00007E486A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

UBE2Q1-AS1: UBE2Q1-AS1 is a long non-coding RNA (lncRNA) that has been implicated in various types of cancer, including ovarian cancer [PMC8521014]. It is part of an autophagy-related lncRNA signature that was established using the LASSO regression method [PMC8521014]. UBE2Q1-AS1 has also been identified as a member of prognostic models for gastric cancer, breast cancer, and bladder cancer [PMC9732092] [PMC9715909]. In bladder cancer, UBE2Q1-AS1 was found to be down-regulated in tumor tissues compared to normal tissues [PMC9715909]. Additionally, UBE2Q1-AS1 has been associated with gastric cancer development and was found to be lowly expressed in gastric cancer tissues [PMC9569729]. It is also part of a prognostic signature for bladder urothelial carcinoma (BLCA) and cuproptosis-related lncRNA signature for BLCA [PMC9289196] [PMC9701814]. Furthermore, UBE2Q1-AS1 has been identified as a risk factor for prediction in kidney renal clear cell carcinoma (KIRC) [PMC9550517]. It is located on chromosome 1 and is antisense to the UBE2Q1 gene. In addition to its association with various types of cancers, UBE2Q1-AS1 has also been found to be part of a larger loop that includes multiple genes involved in various biological processes [PMC6302745].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUAAAGGAGAAACCUGAAUCAUUACAUCUCCUCUCCUCGCUACAAAUGCAAGGCAUGAAUCAGUUUUAGACUGGAGUUCUGGAUAUGGGUACCAAUGUUGCUGACUGCAAGAGCUUCCAGCCAAUGCCACCUCAGGGGGCAAGCCUACCUCAGGCAUCUCCUCAUCUUCAUCUUCUGAAGACACGUCUUCCUGUGUGCACUGCAGCAAGGAAGGGAAAGAUGGAGAUCAGAGCCCCAGUGGCUUGCUAGAAUGCAGCCUCCAACCUACUCCCCUGAGCCCCCAGGUCUGGAAGUUGUGCGCCUGCCUGUAAUGCUGCCAGUCUCUCCACCAGCCAGAUCUGAGUGGAAGCAACAGCCCAGGGAAUGGCUUUGCUACCAGCCCAUUAUUUUUCGCCUAUCACUGCCAAAGAAUAAAAGAAAAGCAAAAUGGCUGUCUCUGUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications