v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) RERE antisense RNA 1 (RERE-AS1) URS00007E47C9_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RERE-AS1: RERE-AS1 is an m7G-related long non-coding RNA (lncRNA) that has been identified as a potential prognostic indicator in breast cancer (BC) [PMC9608183]. It is one of the eight m7G-related lncRNAs, along with BAIAP2-DT, COL4A2-AS1, FARP1-AS1, NDUFA6-DT, TFAP2A-AS1, LINC00115, and MIR302CHG, that were selected to construct a prognostic indicator using the LASSO Cox regression algorithm [PMC9608183]. These eight lncRNAs were also identified as diagnostic biomarkers for BC [PMC9608183]. Kaplan-Meier survival analysis showed that BAIAP2-DT, COL4A2-AS1, RERE-AS1, NDUFA6-DT, TFAP2A-AS1 and LINC00115 were associated with a good prognosis in BC [PMC9608183]. Furthermore, univariate Cox regression analysis revealed that RERE-AS1 was one of the 11 m7G-related lncRNAs tightly associated with BC prognosis [PMC9608183]. The expression levels of RERE-AS1 varied according to tumor stage and T stage in BC patients [PMC9608183]. RERE-AS1 has also been found to be elevated in patients with facioscapulohumeral muscular dystrophy (FSHD) [PMC7567883]. In this study on BC prognosis and clinicopathological characteristics, tumor immune cell infiltration and tumor mutational burden (TMB), RERE-AS1 was selected as one of the differentially expressed m7G-related lncRNAs with prognostic value in BC [PMC9608183].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCACGGAAAGAUGGCCCUGCCCUCAAGGAGCUGCAGUCUGCCCAGGAAGGCAGACAGAUAAACUGCUAUAGUUUUCCACUAUUGAGCUGAAUUUCGUAUCACCAUCAAAAGUUACCUACCUACAAGUCCCUAGUAGAGAAAAUUUAACUUCUGGCUUUAAAAAAGGGACAGAAAAGCAGGCAGAUCUGCUAGUAAGCAAACUACAGCUCCCCCGAGGAGACACACAGGCAGUGGGUAAGAGGAACAGACCCAUGGCUCCACUGAAGACACAGAGCAGCAGACGAAAAAGACAUGUCCUAAAUGUUAAAUGAAUGUGACAGAAUGAUACCAGGUGACUUCUAAGACUACAUCAUACAAAGCAACACAGCUUCUGCUGGGCUCUCCCUCUCUGGACACGUGUCUUUGAAGCCCUGAGCUGCCAGAUUAAACAGUCCGGCUUGCCUAAAGUCACCACGCUGGAGAGACCAUCAGGGAUGGAGAGGUGCUACAGAAACCCUAGCUAUUCUAGUCCCCAGCCAUUUGAGUCUUCCUAGCCCAGACUCAUAAGUGAAGAAACCUUCAAGAUGAUUCCAAUACCUCCUAUCACUUGACUGCAACCUCGUGAAAGCCUAAGCCAGACCUGCACGGUGGAGCCAUUCCUAAAUUCUGGUCCCACAGAAACUGUGAAAGAUAAUAAAUGAUCAUCAUUGCUUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications