v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) PTGS2 antisense NFKB1 complex-mediated expression regulator RNA (PACERR) URS00007E42F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PACERR: PACERR, a gene specifically dysregulated in NDMM (Newly Diagnosed Multiple Myeloma), has been identified [PMC6628062]. In a study, transwell assays were conducted to investigate the effects of PACERR knockdown in co-cultured TAMs (Tumor-Associated Macrophages) on the invasion and migration ability of PDAC (Pancreatic Ductal Adenocarcinoma) cells [PMC8858628]. The results showed that PDAC cells co-cultured with PACERR knockdown TAMs exhibited significantly lower invasion and migration ability compared to those co-cultured with control TAMs [PMC8858628]. This suggests that PACERR may play a role in promoting the invasion and migration of PDAC cells [PMC8858628]. The dysregulation of PACERR in NDMM and its impact on PDAC cell behavior highlight its potential as a therapeutic target for these diseases [PMC6628062]. Further research is needed to fully understand the mechanisms by which PACERR influences tumor progression and metastasis [PMC8858628].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCUGUCUGAUCCCUCCCUCUCCUCCCCGAGUUCCACCGCCCCAGGCGCACAGGUUUCCGCCAGAUGUCUUUUCUUCUUCGCAGUCUUUGCCCGAGCGCUUCCGAGAGCCAGUUCUGGACUGAUCGCCUUGGAUGGGAUACCGGGGGAGGGCAGAAGGACACUUGGCUUCCUCUCCAGGAAUCUGAGCGGCCCUGAGGUCCGGGGGCGCAGGGAAUCCCCUCUCCCGCCGCCGCCGCCGUGUCUGGUCUGUACGUCUUUAGAGGGUCGAGGAAGUCACGUCGGGACAGACUGGGGCGAGUAAGGUUAAGAAAGGCUGACAUGUUUUAUGUUUUAGUGACGACGCUUAAUAGGCUGUAUAUCUGCUCUAUAUGCAGCACAUACAUACAUAGCUUUUUAAAAAACUCUUAUUUUGUGGAAUGAAAUAGCUACCUUCAGUGUACAUAGCUGUAAUUUAUCUUUGUAGCUAAGUUGCUUUCAACAGAAGAAAUACUGUUCUCCGUACCUUCACCCCCUCCUUGUUUCUUGGAAAGAGAGGCGGGAAAGGUAAAUUCUCCUCAUAAUACUGGUCCUAAGCAGUUACCCUGUAAAUAGUUAAUGUGAGCUCCACGGGUCACCAAUAUAAAGUUUCCUGCCUUCUGAUGGACAAAGGAAGCGGCGAUGGCCAGAAUUUGCAGGGACGCUAAAUGUCCAAAACGUAUGCCUUAAGGCAUUUCUCUCCCUGAUGCGUGGAUUAUUUUGGUUACUAGCCCUUCAUAGGAGAUACUGGUAAAAUAAAUUCGAGUUUUAAAGUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications