Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1762 (LINC01762) URS00007E4219_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01762: LINC01762 is a nonprotein-coding transcript that is involved in the prognosis of colon adenocarcinoma, hepatocellular carcinoma, and renal cell carcinoma [PMC9960235]. In colorectal cancer (CC) cell lines, the expression levels of LINC01762 were remarkably lower compared to normal colon cells [PMC9960235]. LASSO regression analysis identified LINC01762 as one of the 10 prognosis-associated long noncoding RNAs (lncRNAs) in CC [PMC9960235]. Patients in the high-risk group had low expression levels of LINC01762 [PMC9960235]. A prognostic model was constructed using a risk score formula that included LINC01762 as one of the variables [PMC9960235]. This model was specific to CC and differed from prognostic signatures identified in other cancer types [PMC9960235]. In addition, AL031985.3, FARSA-AS1, PDE9A-AS1, AC104964.3, and AC092375.2 also showed lower expression levels in tumor tissues compared to matched-peritumoral samples [PMC9960235]. Furthermore, an intron variant was found in a repeat region within the gene for LINC01762 [PMC5947520]. References: - PMC5947520 - PMC9960235

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUCAUGUAGGGGCACUGGACUGCCUAGAGUUGGAGGAAGGGACCCUGUUCUCACAUCGCUUUCCUGUUUCCCUCUCCUGCAAUAUGGAUUUGACAUAUUAAUCAUUACAGCAACUGCUAAAAUUCCACUGUGCUUCAUUAAUCCGGAGGAAAAUACCAUGUCAGCUGGUGCUGUGGGGAUACUGCAGCAGCUCUCUGUCCUUCCAGUGUCUCCAGGGAAGAACAUCUUCCUCUCAAGUGAACAGUGCUUACCGCUUCAAGCAUCCAGUCUCAGCAAUAAGAGGAGCACAUCUCCAAAUUUAUAAUGAAAGACAAGCAAAGUGGGACUUCAUGGCCUUGGCUGGACACCAAGUGAUAGCUAAUUUUUGCAGCAGGGAAGACGAAAUAACAAGUCCCUGGAUUGCAAUUUUGGUUUCUCCUUCUGUUCUCAAACAAAAAAUUGUUUAAAUAAUAAACUCUUGUCUUCAUCAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications