Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) gastric cancer associated transcript 3 (GACAT3) URS00007E409E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

GACAT3: GACAT3, also known as AC130710, is a long non-coding RNA (lncRNA) located on human Chr2p24.3 [PMC8424903]. In a study investigating its potential as a biomarker for bladder cancer, the area under the ROC curve (AUC) was determined for GACAT3, LINC00152, and their combination. The AUC values were 0.8183, 0.7533, and 0.8411 for GACAT3, LINC00152, and their combination respectively [PMC7521261]. To understand the mechanisms by which GACAT3 influences bladder cancer development, protein levels of p21, Bax, and E-cadherin were assessed using western blot assay [PMC7848205]. These proteins are known to play a role in bladder cancer development. Additionally, the expression levels of GACAT3 in hepatocellular carcinoma (HCC) tissues and cell lines were investigated to determine its correlation with HCC [PMC7132227]. Overall, these studies highlight the potential of GACAT3 as a biomarker for bladder cancer and its involvement in HCC development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGACCACAGGCUUUGGUUUCAGGACAAUGCAGACUGGGCAGCAGAUCAAAUAAAGCCAUCACCAGCGCAUAGGACAGUCUCAAGGGGGUUAACUGUCCCUGUCCUCUACAAUUGUUGCUGGGGAGCAAUUUGCCCUUGAAUCUUCCAUACUGUCCCUAAAUUGACAAUUUCAUUUCCUUCCAAUCCCGCCCCCUGCCCUGAAGAUCUGCUGAGGCUGCGAGUUCCAUGUGAGAAGGCAGGAGGAUAAUAGCCAGCUCCUGUGUAAGGAAGUCAAGAUUUUCUCAAGGGAAAAAUCACCCUAGAAACCAUCAACUCAUGACAAACGUGAUCUCCAACGUUCAUUGUGGAAAAUAGCCUCAAGGAUGAGAUGAUGAGGAUUUUGAAGAUGGGUCUUAAGAGAAAACACUGAGGUCCCUCGAAGAUGAAGAAAUCCUCAUGAAGAUGAAUCCAAAGGUGGAUUCAAUUUCAGCUGUCUUUGGACUGAAGACUGCAACAUCAACACUUCCCAGGGUCUCCAGCCUGCCCGCCUCUCCCGCAAAUUUCAGAUUUGCAAGUAUCCACAGUCAUGAGCAAUUCCUUAAAUGAAGUGCAAAAAAUGAACAAGGAGGCCCAAUGAUGCAUCUGCUUAACUUUUCAGUUGUCAAUGCAAAUUAAGCACAAAGAGGACAGAGUUGAUGACAUAUCAGGAACAUUUUUUACUUCCGGAGCAGGUCUGAGUCCCAGCGGAAGACUGAGGCCGACUGAGCCAGAGGCACCACUUCAAUAGGUCACUGGUCUCUGCAGGGAAAGGAAAAGGUGUAAGAGUUCUCCCUGCAUAGAUGCUAUUUGUGACUUGGAUGUUUUCUUUCUAAUACAAAUGCAUCAAAGUGUUCACAGGAAUCUAGCUAUAUGCAAGAAGUCUGGAUUAUCUGCCUGAGAGAACUGGCCAGUAUCUCACCCAUGAGCACCAGAACCCAUUUCUAGAUUACUAAGAAAGGAGCACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications