v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1612 (LINC01612) URS00007E3F2B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01612: LINC01612 is a long non-coding RNA (lncRNA) that has been found to play a role in hepatocellular carcinoma (HCC) [PMC9066125]. Through experiments involving overexpression and knockdown of LINC01612, it has been demonstrated that LINC01612 can promote the degradation of the YBX1 protein through the ubiquitin-proteasome pathway [PMC9066125]. This suggests that LINC01612 may have potential as a prognostic predictor or therapeutic target for HCC [PMC9066125]. Additionally, it has been shown that LINC01612 can interact with miR-494 to upregulate the expression of ATF3 in hepatocellular carcinoma [PMC9066125]. These findings highlight the multifaceted role of LINC01612 in HCC and its potential as a target for therapeutic interventions. Further research is needed to fully understand the mechanisms by which LINC01612 influences YBX1 degradation and ATF3 expression, as well as its broader implications in HCC.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCUCUUGUGAUUGUGACUGACACAGGCAGCACCCUUUUGCAGAAGUAGAUGUGCGUUGCUGAGAAAUUUUCUGCCUAAGUUCUGGUUUUCUUUGCAGCACCCAGCAUUUGUUUCUAACACAGGGAAAGAGUGAGCUGGAGAAACCUCUCAAAUUCAAGAAAGCGUAAAGCAAAUUGAACAAUACGGGUGAGGAGCACGGACUAUUCUCUCAUGUUGAAUGUGGCACUUUUUACAUACAAGCAGGAGAGCAACUACACCAAGAUUUUGGAAAACAUGUUAUGUAAGGUUAAUUGUGACCUCUAUGAUGGGGAUAUGAUAAAGAAGAAAAGUACCUCACAGCGAUGAUUGGCAUGUGAUCACUUAGCCAAUGAGAUAAGAGGCUGUAGAAACGAUGUGAUAAUGACAUCUCCUGAGUUGCAGGUCCAUAUUAGAAGUGGAUAUGAAGUAAACAUUGAGCUUUCCUCACAUUUAAUUAACAAGCUUUAUUAUAGAUACAGCUCAAAUUAGUUAAUUCAGGAAGCUUAUUUUGUAGAAAUUAAAACAUUAAUAAACACAUACAUUUAGAAAUAAAGAACUCGGCUGACCCUUUGACUCUUUGAAACAAGUGGCCUUCCAUGCUGUGAAAGAUUGUAGCCACUCUUUGAGACAUUGGAAUGGUGUCCAUUGCAUUUUAUCAAGUUAACUAUAGGUCAGCCUGGGAAAUCUGAAGUUUCCUUAUCUCCUGUCACUGUGGUUGCUGUGAGAUUUUGUGUCAUCACUGUGCUGUCUUCCCUCUCCACAUGAAGGUGAGCUGUCUGGCUUCACUCUAACGUUUGUGAUUUCACGCCCGACCUGAUUGUUGCCAAGCAAUUCCUUUGUUUGGAGAAUUCUGUGCUUUGUUUAGAAUUUUUUAAAGGUUCUUUUCCUGUGGUCAGAUUUCUGUUUGCUACUGUGUCUUAUGCCUUGUUCUCCUACAGAGAAGAUUCUUUGAAGUUAGUGGAAGCUCAGCUUAAAGGAAGAUCUACUGCUCUGUGUGGUGGAUGACCAUGGGGGAGCGAGAAGGCAGCCUCCGGCUUUUGUUUUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGAUGUACCUGGAAAAAUAACACGACUAGGAUUAAAGAGUAUGUUUGGCAUGUUUAAAAUAAAUUGUAAACCAAACGUAUUUUAAAGAAUUUAUACAAAUUUGUCAUUUAGUAAAAUGAAUGACUAUUGAGUAUUCAUGUCAAUAAAACAACCACUUGAAUACAACAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications