v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1291 (LINC01291) URS00007E3AFB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01291: LINC01291 is a long non-coding RNA (lncRNA) that has been studied for its impact on tumor growth in vivo [PMC8940622]. In a study comparing the expression levels of various lncRNAs in different cell lines, including T24, J82, and TSGH-8301 cells, it was found that LINC01291 had at least a two-fold higher expression in T24 and J82 cells compared to TSGH-8301 cells [PMC7349410]. This suggests that LINC01291 may play a role in the development and progression of tumors. To further investigate its impact on tumor growth, A-375 cells expressing stable sh-LINC01291 or sh-NC were injected into nude mice [PMC8940622]. This experimental approach allows for the examination of how LINC01291 knockdown affects tumor growth in vivo. By comparing the growth of tumors with and without LINC01291 expression, researchers can gain insights into the functional role of this lncRNA in tumorigenesis. Overall, these findings highlight the potential significance of LINC01291 as a target for further research into cancer biology and therapy development.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCACCGCUCAAUGAAGUCUUCCGCAUUCAUCACCUUUCAAACGGAAAUAAAACUUUAACCAAAAGAGCAUGGGCAGAUAUUUCCCGGAUCUGAACAGGAAUAGCUGGUGUCUGGACUCUAUGAAGAAUCUUCAUGUGCAGUGAUAGAAGAAUAAACACAUUUGAACCAAGUUCACCAUGGAGAGAGUGAGUGGGUUGGGGAAAAGGUGUUGUAUGUUUGAGGAGCGAGGAGAAGGUGUCAAAUAAUCAUCCAGGCAGACUUUUGUAGUGCACAGUGACCGGUGACCAGCAGCAUGUGUUUCCAUAGGCAUCUUCUCUCAGUACCCCAGAAGGUGAAUUGCCAGUGAGUCCUGCCAGGAUGCCCCUCGGUGACUGCACCACCCAGUAAAAAGACAUCCCUUAACUAUGGCAAAACAACAACAACAACGACGACAAAAAACAAAACAAAACAAAACAAAACCCUGCAUCAAUUUGAUAAAUAAUCCUCCCCGUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications