v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1317 (LINC01317) URS00007E39B5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01317: LINC01317 is a non-protein coding RNA that is transcribed from DNA but not translated into proteins and is generally associated with the regulation of gene expression [PMC6901591]. In a study, a total of 16 lncRNAs were eliminated, and the remaining ones, including LINC01317, were included in a model to predict overall survival in the scenario of papillary renal cell carcinoma (pRCC) [PMC9139553]. These lncRNAs were combined with other well-known lncRNAs to create an innovative tool for survival prediction in pRCC [PMC9139553]. Cox regression analysis identified 26 significant differentially expressed cancer-related lncRNAs (DECRLs) associated with pRCC patient survival, and 10 of these lncRNAs, including LINC01317, were included in a risk model for survival prediction [PMC8525017]. The risk model was constructed using the expression levels of these 10 lncRNAs and their corresponding coefficients [PMC8525017]. Additionally, LINC01317 was found to have three single nucleotide polymorphisms (SNPs) that showed suggestive association with eosinophilic esophagitis (EAA), and two other SNPs in LINC01317 also showed suggestive association with EAA [PMC6901591]. These SNPs may have implications for the development or progression of EAA [PMC6901591].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGCCACCACGUAAGAAGUGCCUUUUGCCUCCCACCAUUAUUCUGAGGCCUCCUCAGCCAUGUGGAACUGAUGACACAUCUAGAAGACCCUCACCUUAUGCUUAUGCUGGCCCCUUGAUCUUGGCCUCCAGAAAUGUAUAAUGAAGAAUCUUGAGGUCCUCCUGGAUUACCAAAGUGGGCCCUAAAUCCAGUGGCAGAAGACACAGACACAGAGAGGAGACCAGGUGAAGACAAAAGAAGAGGCUGGAGUGAUGCAACCAUCAGAGAGUGAAAAUACUCAGUUACCUCCUGGUUUAUGAGGCAAUGAAGUAUUCCAGCACAUAAAUAUUGACGCUGAGACCCAUGGGAUGUAGGAGUGCUGAGCACAUUUGCAAGACAUAAAGACCGAAGAGGUGAAUCACUUCAAAGAGAAGGACCAGAUUCUCAUGGACCCCACUGCCAUGCUGGCCAGACAUCUUGCUGCCAUUGUUUUCCUGUUAUUUACUCCCAAACAGGCGGAGUGUCGCUCUGUCACCCAGGCUGGAGUGCAGUGGCACGAUCUCGGCUUACUGCAAGAUCUACCUCCCGGGUUCACGCCAUUCUCCUGCCUCAGCCUCCCGAGUAGCUGGGACUACAGGCGUCCGCCACCACGCCCGGCUAAUUUUUUGUUUUUUUUAGUAUAGACGGGGUUUCACCGUGUUAGCCAGGAUGGUCUCAAUCUCCUGACCUCGUGACCCGCCCGCCUUGGCCUCCCAAAGUGAAGUCUCUUUUCAAAAUCUUAAUGCUUACCUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications