v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) CCND2 antisense RNA 1 (CCND2-AS1) URS00007E3987_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

CCND2-AS1: CCND2-AS1 is a long non-coding RNA (lncRNA) that has been found to be highly expressed in various types of cancer, including papillary thyroid carcinoma (PTC), glioma, breast cancer, cervical cancer, and hepatocellular carcinoma (HCC) [PMC8383148] [PMC6356972] [PMC7844725] [PMC9634578] [PMC7436925] [PMC5663614]. It has been shown to play a role in promoting cell proliferation, migration, and invasion in these cancers through various signaling pathways such as Wnt/β-catenin signaling [PMC8383148] [PMC6356972]. CCND2-AS1 has also been identified as a diagnostic and prognostic marker for PTC and is associated with deregulated cellular growth in this cancer type [PMC7332117]. Additionally, CCND2-AS1 has been found to be involved in the regulation of pyroptosis in HCC and is negatively correlated with the expression of CASP1 in this process [PMC6038674]. It is worth noting that CCND2-AS1 is an antisense RNA located within the intron of the CCND2 gene on chromosome 12 and is involved in cell proliferation associated with adipogenic and myogenic cell lineages during early development [PMC9180923]. Overall, CCND2-AS1 appears to be an important player in promoting tumor growth and progression through various mechanisms across different types of cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AAUGCACAGCUUCUCCGCGGUCAGCGGGCUGGUCUCUUUGAGUUUGGAGGCCAGGAACAUGCAGACAGCACCCAGGAGUUGCAGAUGGGACUUCGGAGUCGGGACCCCAGCCAAGAAACGGUCCAGAAGAAUCUACCAUAAAACCAACAGACUCCUCCUGAUCUCUACCUGUGCUGUCUGCCUCUCUAGUUCCGGACACUGAGAGCUGGUGCCCUGUGGCCACCUCAAGCUGGAACCCUGCAAGAUCACCAAGAAGACUGCAUGCCUCGCUCUAGCCUUCCUAAGGGAAAGUAGACUCCUGUUUUUGAGAGAAAUUACCUGAUUUCAAGAGAAACAUAAAGGACUUUUUUUCCCUUAACAUUCCACUCGUAAAAAUGAAGUUUGGAAGAACUUCUGCAAACUCUGAGUGUUUUGGUCAAUUGACCUUUUACUGUACUAAGCAAAUCUGAAGCCACAAAUACAUUGGGGAGGAAGGUAUACCCUUCACAAAAGAUCCGUCACUUAGCCAGAUACUCUGUUGCCAUGCUUCUUUAAAUAAAGCACAUUUCUGGUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications