Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1740 (LINC01740) URS00007E35EF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01740: LINC01740 is a gene that has been studied in the context of lung adenocarcinoma (LUAD). In a study, it was found that the expression level of LINC01740 was lower in the high-risk group compared to the low-risk group [PMC7212445]. Additionally, high expression of LINC01740 was associated with good survival outcomes [PMC7212445]. The study also identified LINC01740 as one of the four genes (along with miR490, miR1293, and IGF2BP1) that could serve as prognostic biomarkers in LUAD [PMC7212445]. However, it is worth noting that there is no public report on LINC01740 according to a PubMed search [PMC7212445]. Despite this, LINC01740 was still identified as one of the predictive genes for LUAD [PMC7212445]. The prognostic value of LINC01740 was found to be unsatisfactory [PMC7212445]. Therefore, in a Cox regression analysis, miR490, miR1293, LINC01740, and IGF2BP1 were included as variables [PMC7212445]. Reference: [PMC7212445] Liang W., et al. (2020). Identification and validation of four genes for predicting prognosis in lung adenocarcinoma. PeerJ. 8:e8758.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGUCUGUAUCUCAAAGCCUUUAAAAUGCUGAUGGAAGGAGUGGAGAUCCAGCGUUCAGGGUAGAAAAGAGGAAAAUCCAUGGAACCAUAAUCUAUGGAUGGCUUUAGGAAUGGGAUUGACUGCAAAGGAGCACAAGGGAACUUCCUGGGGUGAUGGAAAUGUUUUGUCUUGAUUGUGGUAAUGAUUACAUGACUAUGUUUGUCAAAAUUCCAGAACUUUAUACCUAAAAGGGUGAAUUUUACUGCAUGUAAAUUAUACCUAAACACAUGACUUUUUAAAAAGGCCUGAAAUCUUAACUACUCAGCUAAAAAUAAAAUAAAAUAAAAUAAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications