Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) BBOX1 antisense RNA 1 (BBOX1-AS1) URS00007E3393_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BBOX1-AS1: BBOX1-AS1 is a long non-coding RNA (lncRNA) that has been investigated for its involvement in the regulation of PHF8 and autophagy in hepatocellular carcinoma (HCC) [PMC9852557]. The study aimed to determine the role of BBOX1-AS1 in HCC and its potential interaction with miR-27a-5p [PMC8086369]. The results showed that exogenous expression of miR-27a-5p counteracted the promotive effects of BBOX1-AS1 on cell migration, invasion, and epithelial-mesenchymal transition (EMT) [PMC8086369]. This suggests that BBOX1-AS1 may exert its effects on HCC progression through regulation of miR-27a-5p. Additionally, qRT-PCR was used to measure the expression of BBOX1-AS1 in nuclear and cytoplasmic fractions, with U6 and GAPDH serving as respective reference genes [PMC8086369]. This technique allows for the assessment of subcellular localization patterns of BBOX1-AS1, which may provide insights into its functional mechanisms. Overall, these findings highlight the potential role of BBOX1-AS1 as a regulator in HCC through its interaction with miR27a5p and suggest a possible involvement in cellular processes such as migration, invasion, and EMT.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUUUGAUCUCAGACUGCUGUGCUAGCAAUCAGCGAGACUCCGUGGGCGUAGGACCCUCCGAGCCAGGUGCGGGAUAUAAUCUCGUGGUGCGACGCUUUUUAAGCCCUUCAGAAAAGCGCAGUGUUCGGGUGGGAGUGACCCGAUUUUCCAGGUGCCGCCCGUCACCCCUUUCUUUGACUCAGAAAGGGAACUCCCUGACCCCUUGCGCUUCCCAAGUGAGGCAAUGCCUCGCCCUGCUUCGGCUCGCGCACGGUGCGCGCACCCGCUGACCUGCACCCACUGUCUGGCACUCCUUAGUGAGAUGAACCCGGUACCUCAGAUGGAAAUGCAGAAAUCACCCGUCUUCUGCGUCGCUCACGCUGGGAGCUGUAGACCGGAGCUGUUCCUAUUCGGCCAUCUUGGCUCCUCCUGUAACAAUUUCUUGAGAUGAAGAUCCUGAAUACCAAAGAGGGCCGCUGACAGGUCUAGGAGUACACUUCUAGCACCUAGCAGAGAGAGGCUUCACUACAUCAUGCUUCCUGACAUCUCUCCCUUUGAAGAGCAGUCAGACUCCUGCUUUGCUCUUCAGACUUAAUUUGGGGGUUUAACAGCCAUGUGAAGUGCUCACUCCCCCUUUGCCUUCUGCCAUGAUUGUGUGUUUCCUGAGGCCUCCCCAGAAGCUGAGAAGAUGCUUCCUGUACAGCCUGCAGAACUGGAUAGCCCAGAGCUAUUCCAUGUAUUCCAUGGAUGGGCACAUUUGGAAGUUUGGUUCUAAAAUCUAAAAGAAGAAAUUUAAGUGUGCUGAAGAUAACUGCAACUCCAAACCUAACGCUGUGUAAUUCUAUGUUCUGCCAUUUUGAAGCAAAGUGGAACCAGAAGUGAGAGGACUAUUUCUAGGUCAUGCUACGGUUACCCUGACCCCAGUCACUCCCUAUGCUGGUCCAUCCAAACUCAGAGCCACGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications