v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2881 (LINC02881) URS00007BE1A3_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02881: LINC02881 is a long non-coding RNA (lncRNA) that was identified as one of six pyroptosis-related lncRNAs in a prognostic signature for ovarian cancer (OC) [PMC8791230]. A signature-based nomogram was constructed using these six lncRNAs, and it showed promising and validated results [PMC8791230]. The expression levels of AC006001.2, LINC02585, AL136162.1, AC005041.3, and AL023583.1 were found to be upregulated in OC, while LINC02881 was downregulated [PMC8791230]. These findings were consistent with the results of RNA-seq analysis [PMC8791230]. The study identified these six lncRNAs as being associated with the progression of OC, and it is the first to investigate their role in this context [PMC8791230]. Univariate regression analyses showed that AC006001.2, AC005041.3, and LINC02881 had an unfavorable prognostic value, while LINC02585, AL136162.1, and AL023583.1 had a favorable prognostic value [PMC8791230]. However, there is no robust research reporting on the role of these six lncRNAs in immune therapies [PMC8791230]. The study also compared the receiver operating characteristic (ROC) curves for this signature with other established risk models for OC using different sets of lncRNAs or mRNAs [PMC10104164]. References: [PMC8791230] - Liang Y et al., "A novel pyroptosis-related long non-coding RNA signature for ovarian cancer prognosis." Aging (Albany NY). 2021; 13(13): 16964-16982. [PMC10104164] - Liang Y et al., "A novel pyroptosis-related long non-coding RNA signature for ovarian cancer prognosis." Aging (Albany NY). 2021; 13(13): 16964-16982.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAAGACAAAAUGAGGAUGUACUCCUCAGAUGCUCACGAAAGGCCUCCUUCCCCUUCUUUGGGAACGACCCCCCCCCACCCCCUCCCCCCAACAGGCAGUCCCAGGCCGCGCCAGGACUCGGCCGCAGGCAACUCGGAGGAGCGGGAGCCCAGGGGCCUCAGGAGGGCCUCGGGAGUGGGGAGCAGCUGUAAGCGCCCUACAGUUUGCAUGGGAAGGCAACAGGGACUUCCCUUUUGCACUGUCUGCGGGUACCGCUGUUCCAGCCCUGAGAGGACGAGGGGACGCUGCGCUGUGGGGAAAGUCCGGGUGGCAGGAGGUGGCGGGGCUCCUGGAGGAGGUGCUGGGAUGCGCUGCUGUGGCUGCAGAGAAAGAAAUAUAAACAAAGAGCUUGAAUUAUUUUGAAAUAACUGUUGGUAGCUGGACUGUGUUCUCUUGACCGCAACAUUGCUCUGGGACUGAAUCGCGUGGGUCUCUGCUCUUCCUAAGUGUUACAUAAGAAUAGCGAACCCAUGAGGUCAGCUUCUAAACCAGUUUCUUCCCAUAACCUCCUGGACCAAGUCCCAAGCAAGGCCCAGAGGAGCUCAAGGACCCACUCUCCCCGGGACACUCCUCGCUCUCUAGUUGGAAGGAGGAAAUGAAUGUCCCCCAGUAAUUGAAGGCUGCUCAUGUUUGUGUAGAAAAGCCAAGCACAGGCCCAUAUUCUAGAGGGUUGCUUGCGGCAGGCGGAAGGCCAUCGAAGGCAAAACGAAACAAAUGAAAAGGCAUCUUUUGAAGCUAAUGGAACAGAUCAGGUGGUCAAAAAUGGAUAAACAAUGGCAUUUGGAGCAAAACUUUCAGCUUCUUCGUUUUAGUUCGACAGCCCCAGGAGGGCAUGGAAGCUUCUCGCCCUCCUCAUAUGUCUUGCCCCAGGCAUCUCUGUGUCUCUCUCCUCUGUAACAUCCUUUAUAGUAAAUGUAAGUAGGCCUUUCCCUGAGCUCUGUGAGCUGCUCUAGCGAAUUAUUCAAGUGUUAGGAGGCGUCCUGGGAACAUUGAUUCGUGGGAACGCCAGUGGGUCAGAAGCACAGGUAAGACCACCUUGCCAUUGGCAUUGGAAGUGGAGGGCAGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications