Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-605-3p URS0000785093_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-605: Hsa-mir-605 is a microRNA that has been identified in various studies and has been associated with different biological processes and diseases [PMC7115244]. In previous research, hsa-mir-605 was matched with identified differentially expressed miRNAs (DEMs) [PMC7115244]. It has been reported that hsa-mir-605 is associated with impaired spermatogenesis in patients with male infertility [PMC6024298]. Additionally, an SNP within hsa-mir-605 has been identified as a potential modifier of the Li-Fraumeni syndrome phenotype [PMC9367397]. Hsa-mir-605 has also been found to be downregulated in the blood of patients with complex regional pain syndrome (CRPS) and poor analgesic effects of ketamine [PMC9668864]. Furthermore, hsa-mir-605 has been shown to be part of the microRNAome in colorectal cancer but not yet demonstrated in melanoma [PMC4516543]. In various studies, hsa-mir-605 was found to be differentially expressed and associated with survival curves in different diseases such as preeclampsia, melanoma, and lung cancer [PMC8683174]. The expression level of hsa-mir-605 was found to be downregulated compared to other miRNAs such as hsa-miR-221 and upregulated compared to miRNAs like hsa-miR-23b and hsa-miR-125a-5p [PMC3377643]. Overall, these studies highlight the potential role of hsa-mir-605 in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAAGGCACUAUGAGAUUUAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications