Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LMO7DN intronic transcript 1 (LMO7DN-IT1) URS0000784D15_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LMO7DN-IT1: LMO7DN-IT1 is a long non-coding RNA (lncRNA) that has been identified as one of the differentially expressed lncRNAs in osteosarcoma (OS) [PMC10101303]. In a study comparing OS and normal bone samples, LMO7DN-IT1 was found to be upregulated in OS samples [PMC9680297]. The study also identified other upregulated lncRNAs in OS, including ERI3-IT1, SND1-IT1, ANKRD44-IT1, AGAP1-IT1, DIP2A-IT1, SLIT2-IT1, RNF216-IT1, and TCF7L1-IT1 [PMC9680297]. The subcellular localization of these lncRNAs was determined using the LncLocator tool. ERI3-IT1 and SNDI-ITI were found to be located in the nucleus while NRGI-I Tl. FGF14-I Tl. ANKRD44-I Tl. LMO7DN-I Tl. SLI2-I Tl. RNF216-I Tl. and TCF7L I - I TI were located in the cytoplasm [PMC9680297]. The study also highlighted that NRGI - IT 11 FGF14 - IT 11 and HAO2 - IT 11 were downregulated in OS samples compared to normal bone tissues [PMC9680297]. However, there is limited literature available on these lncRNAs in tumorigenesis [PMC9680297]. In another study on OS subtypes, LMO7DN - IT 11 was found to have higher expression compared to other subtypes [PMC7961759].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UACCCAGAAGGAUCCUGAAGCUCACAGAGGUUAUGUAGCCUGCCUAAGGUUACCCAGCUAGCAACUGGCAAAGCUAGGAGUUGCUGCAGAAUAGCAAGCCUAUCACUCACAAUGGCCAGAAAUCAGAACAAAUGAUCAUUACAAACAACCCAUGUAGACAGUUUUCUAUCGUAAGGCAGUGAUUUUUGAGUCCAUAGAUGGGCCAGUAGGAAGUCUACACUGAAAUCAGCAUUGUGCCUGAUACUGAGAGGAAUAAAGUUGAUAGGAAGGAGCAAUCAGAAAGCUUUGGCUGAAAAGAAUGAUUUAAACCACUGGAGAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications