Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) THBS1 antisense RNA 1 (THBS1-AS1) URS000077D724_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

THBS1-AS1: THBS1-AS1 is a long non-coding RNA (lncRNA) that has been found to play a role in regulating cardiac fibrosis [PMC10070117]. In a study, it was observed that knockdown of THBS1-AS1 in activated human cardiac fibroblasts (HCFs) led to the suppression of fibrosis markers such as POSTN, CTGF, and α-SMA [PMC10070117]. To determine the subcellular localization of THBS1-AS1, nuclear and cytoplasmic RNA fractions were extracted and analyzed using reverse transcription PCR (RT-PCR) [PMC10070117]. The results indicated that THBS1-AS1 is present in both the nucleus and cytoplasm of activated HCFs [PMC10070117]. Furthermore, it was found that THBS1-AS1 regulates cardiac fibrosis through its interaction with TGFBR1 in activated cardiac fibroblasts (CFs) [PMC10070117].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGUAAGAUAUUAUAGGGUAUAGGGAACCGAUAACUUGUUGGGAUUAUGUUGUCCACCUGCAUCUUAGAGCAAUCAAAUCGCUCAGGACUAACCAAGCUGGAAUCUCCUCGAAUGCUGACUGCAGCAUUCAGUAAAAGAGCAAAGCUCCUGGGUCGUUUCAUCCUGGGCUGCGUGGCUCACCAAUUGGACAGUCCUGCUUGUUGCAGAUCUGGUUUUCUGUUACAUCACCAACGCAGUCCUUGCCUCCAAACUGGGGUGUGGGGUUGUUGCAGAGACGACUACGUUUCUGUACCCCUCCUCCACAGGUGACAGAACAGAUGUCCCAUGGUGACCAAGGACCCCAGCCUCCAUUGACUGUAAGAAGAUGAACCACAGGCAACAAUUAAGAUCAACUUUCAAAUCCCUCCCUUGUCAUAGACUCUCCUAAGCCCGUUCAAGAAACCUCUGCUUCUCUGACACAUGGAAAGAAUGCUGGGGAAGAGGGUGAGUUUGUUUUUCAUUAAAAGAAGUUGCUGAGCCUGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications