Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ANKRD10 intronic transcript 1 (ANKRD10-IT1) URS0000764FAC_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ANKRD10-IT1: ANKRD10-IT1 is an intronic long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It is predicted to be involved in G alpha (12/13) signaling events and the Rho GTPase cycle [PMC8484874]. In the context of cancer, ANKRD10-IT1 has been found to be associated with poor prognosis in several types of cancer, including hepatocellular carcinoma [PMC7040247] and esophageal squamous cell carcinoma [PMC7884852]. It has also been included in prognostic signatures that predict the outcomes of patients with hepatocellular carcinoma and clear cell renal cell carcinoma [PMC7040247, PMC9843365]. ANKRD10-IT1 is part of a six-lncRNA signature that shows prognostic relevance in hepatocellular carcinoma [PMC7040247]. In addition, ANKRD10-IT1 is included in a 10-lncRNA signature that predicts prognostic risk in triple-negative breast cancer [PMC9843365]. Furthermore, ANKRD10-IT1 has been identified as one of the top downregulated lncRNAs in certain cancers, such as glioblastoma multiforme and esophageal squamous cell carcinoma [PMC8420065, PMC9593037]. Overall, ANKRD10-IT1 appears to have potential as a prognostic biomarker and therapeutic target for various cancers.

Targeting miRNAs 7 total

According to LncBase, this RNA is targeted by the following miRNAs:

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAUACCUCACUUGAGGUUGACAGGAGUGGCCAGCAGUUAGUGCCUAUGGUCAUGUAAUACACUAAGUCAAUACCUGUGGAGUGAAAUCCGGUCUCUAUAAAAAAUACAAAAAAAAUGGCGUGAGCCACCGUGCCCAGCAUGGUAUUUAUGAUUCUAAGUGCCAUUUCAAAAAUCUGUUUGCUCUUUUUUAUUCUCUGGUCCACUAAAGAGUAAUCUUUACUGUGGGCUUUAUUUCAUAUUUUUAUUUGUCCUAAUACUAAGUGGUAGCUUCUCAUUUCUCUGUUUCUUGAUUUUGGAGAGCAAGUCUAUGCUUAUCUAUAGAAAUAAUCAGUUUGUAAACUUAUGUUCUCCUUGAAGAGUUUUUGAAUUUUCAUGUGGCAACUUAUUUUUCUGUUCACAUUCUUGACAGAAUAGACCCUCCCAGGUCAUCUGCACUUCUGAUAUCUUUUGAAAGUGAAAUAUACCAUUAAAAAAAAGUCCAGCUAUAUGAUGAAGCUGUCACGUAAUAUUAGUAUAUUUUCUAUUUCAAUAACAAGGUGAUCUGAUUUUGUACAAAGUAUAAUUAAUGUAAUACAAUCUGCCCAAACUUUGGUGCUUCCUUUUCAUUUAAUUCAUAUAUCAAAAUAAAAAUAUUAUGCAAUACUAGAAAAUACUCAUGGCCAUUCAUAGCCAUGCAGUCUUAAUAAGGCUAAUAAAAAUAGUGACUUUAGUCUGUAAUAGUCCUGCACAUAGCCGCCUUAUAUUUUUAAGAAUUUUGUUGGUUUCUGAGAUUCUCAAUUCUCUUUUAUCUCUGAUCAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications