Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-3158 precursor (hsa-mir-3158-2) URS000075F0B6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3158-2: MIR3158-2 is a gene located on chromosome 10q24.31-10q24.32 that is involved in the development of Split Hand/Foot Malformation (SHFM) [PMC5003447]. In SHFM cases without microarray data, the shortest duplication region includes MIR3158-2, along with other genes such as BTRC, POLL, DPCD, and a portion of FBXW4 [PMC5003447]. In cases with SHFM phenotype and microarray data, the duplication region typically contains MIR3158-2 along with LBX1, FLJ41350, AX747408, BTRC, POLL, DPCD, MIR3158-1 and FBXW4 or a portion of FBXW4 [PMC5003447]. In some SHFM cases with two discontinuous duplications at 10q24.31–q24.32 (Patient 12–15), one segment contains MIR3158-2 along with POLL and DPCD while the other segment contains LBX1 and a portion of BTRC [PMC5003447]. Additionally, in Patient 18 who does not have classical SHFM phenotype but exhibits other symptoms such as short palm and small feet, hypertelorism (wide-set eyes), intellectual disability and obesity; a duplication region at 10q24.31-q24.32 includes MIR3158-2 along with POLL and DPCD [PMC5003447]. These findings suggest that duplications involving MIR3158-2 are associated with SHFM phenotype as well as other developmental abnormalities [PMC5003447].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCAGGCCGGUCCUGCAGAGAGGAAGCCCUUCCAAUACCUGUAAGCAGAAGGGCUUCCUCUCUGCAGGACCGGCCUGAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications