v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1160 (LINC01160) URS000075F019_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01160: LINC01160 is a long non-coding RNA (lncRNA) that has been studied in various cancer types [PMC8765715]. In a study by Zhang et al., the PI model was validated using eight lncRNAs, including LINC01160, in hepatocellular carcinoma (HCC) [PMC8765715]. The study found that LINC01160 expression was downregulated in HCC tissues compared to adjacent healthy tissues [PMC8765715]. Furthermore, the expression of LINC01160 was included in the risk score calculation for HCC prognosis [PMC8765715]. The study also analyzed the differential expression of lncRNAs in HCC tissues and found that LINC01160 was downregulated along with other lncRNAs such as NRSN2-AS1, GMDS-DT, LAMTOR5-AS1, SEMA6A-AS1, ADPGK-AS1, and ZBED5-AS1 [PMC8765715]. Additionally, the study investigated the association of these lncRNAs with clinical parameters and found that LINC01160 expression was differentially expressed in tumor stage and tumor grade [PMC8765715]. In another study by Zhang et al., LINC01160 was also found to be significantly upregulated in head and neck squamous cell carcinoma (HNSC) tissues compared to normal tissues [PMC7812288]. This suggests that LINC01160 may play a role as a potential candidate gene in cancer development and progression [PMC7812288].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUCUGCCCGGCCGCCCAUCGUCUGAGAUGUGGGGAGAGCCUCUGCCCCGCCGCCCCGCCUGGGAUGUGAGGAGCGCCUCUACCCGGCCGCGACCCCGUCUGGGAGGUGAGGAGCGUCUCUGCCCGGCCGCCCCGUCUGAGAAGUGAGGAGACCCUCCGCCUCGCAGCCGCCCCGUCUGAAAAGGUGGCUGUCAAUAGAUUGGCCCAAAAGGAAGAACAAGGAAAAGGGCACCAAAGAAGAUAAAUGAAAAUACAAGGGUAUAAGCUGAACUGUGGACAUCCUGCCACUGGGAAUUAAGUUAAAGUAGAAAAAAGCAGAAUGUAAUGGGGAGUCCCCUCACAAGAAGAAUUUGGAUCAAAGCAUGGCAGUGAGGGGAAGCAUUGAGCAGUGCCGAUUUCAAAUGAAGACUGACUUGAUCCUGAACAUAACCUACAAGAAGAAAGGGACCACAGGCUAUACACAAAGCAUGGUGCCGGCAUCUGCUUCUGGUGAGGGCCUCAGGAAGCUUACAAUCAUCUUGGAAGGUGAAGAGGAAGCCAGCGCAUCACAUGGCAAGAGAGGGAGCAAGAGAGAAGGGGACAGUGCCGCACACUUUAAAAAAAAACCUUAUCUCACGAGGCAGAACUAACUGAGUGAGAGUUCACUCAUCACCAAGGGAAUGGUGCUGAGUCAUUCAUGAGGGAUCCCCCUGCCGCCCCCGUGAUCCAAUCACCUCCCACCAGACCCCACCUCCAACACUGGGGAUUACAUUUCAACAUGAGACUUGGGGGGGACAAACAUCCAAACCAUGUCAGUCUUCAACCCCUCUUCCUGACAUACAACUCCUAAAACUCUUAGAAUCUCCAAAGUGCUGUCUUUUUAUGUGUUAGUAAUUGGCUAGUGGCUCACAGCCCCUUGGUAGCUUCAGGAUGGGGCCUGGUCACUGGAAAGACCAAGUCAUAAUUAGAGGGUUGAGACUUUCAGCCCACCCCCAACAUCUGGGGAGAAGAGAAGGGCCGAAGCUCAAAUUGAUCACCAAUGGCCAGUGUUUUAAUUAAUCAUGUGGCCAGGCGUGGUGGCUCACGCCUGUAAUCCUAGCACUUUGGGAGGCUGAGGCAGGUGGAUCACGAGGUCAGGAGAUGGAGACCAUCCUGGCUAACACGGUGAAACUCCAUCUCUACUAAAAAUACAAAAAAUUAGCUGGAUGCGGUGGCAUGCGCCUGUAGUCCCAGCUACUCAGGAGGCUGAAGCAGGAGAAUCACUUGAACCCGGGAGGCAGAGGUUACAGUGAGCCGAGAUUACACCACUGCACUCCAGCCUGGGUGACAGAGCCAGACUCCAUCUCAAAAAAACAACAACAAAAAAAGACAAAUAAAAUAAAUAAAAAUAAUGAAUCAUGCCUAUGUAAUGAAGCCUCCAUAAAAACACAAAAGAAUAGGGUUCAGGGAGCCUCUGGAUAGCUGAAUAUCUGGAGGCUCCUAGAGAGUGGCAUGUCCAGAGGGCAUGGAAGCUCUGUGCCCCUUUUUCACCCUAUACACCUCAUCAUCUGUAUGCUUGGUAAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications