Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4721 precursor URS000075EF66_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR4721: MIR4721 is an intragenic miRNA that is involved in the downregulation of GMPPB mRNA in monoculture [PMC7793838]. In the context of the polymorphic inversion at 16p11.2, MIR4721 is upregulated for the inverted allele [PMC9098634]. In a study on low-birth-weight newborns of smoking mothers, hypermethylation of MIR4721 was observed in foetal cord blood, which was associated with altered expression of proteins and key factors for correct placental development [PMC9571148]. Overall, MIR4721 plays a role in mRNA downregulation and its expression can be influenced by genetic variations and environmental factors such as smoking [PMC7793838, PMC9098634, PMC9571148].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGCCUGGUCAUGGUCAAGCCAGGUUCCAUCAAGCCCCACCAGAAGGUGGAGGCCCAGGUGAGGGCUCCAGGUGACGGUGGGCAGGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications