v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MRPS30 divergent transcript (MRPS30-DT) URS000075EF58_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MRPS30-DT: MRPS30-DT is a long non-coding RNA (lncRNA) that is highly expressed in breast cancer and may function as an oncogene [PMC6854119]. Knocking down MRPS30-DT has been shown to inhibit the growth of breast cancer cells in vivo [PMC6854119]. MRPS30-DT has been found to promote breast cancer cell migration and invasion [PMC6854119]. It has also been associated with the expression of Jab1, a protein involved in cancer progression, and with poor survival outcomes in breast cancer patients [PMC6854119]. Knocking down MRPS30-DT has been shown to decrease Jab1 expression in breast cancer cell lines [PMC6854119]. MRPS30-DT expression levels are significantly higher in breast cancer tissues compared to adjacent normal tissues and are associated with a poor prognosis for patients [PMC6854119]. In situ hybridization and immunohistochemical analysis have confirmed the differential expressions of MRPS30-DT and Jab1 in breast cancer tissues [PMC6854119]. Functional studies have demonstrated that MRPS30-DT promotes tumor cell proliferation, invasion, and metastasis while inhibiting apoptosis [PMC6854119]. Knocking down MRPS30-DT significantly inhibits cell growth, migration, invasion, and induces apoptosis in breast cancer cells [PMC6854119]. The upregulation of MRPS30-DT is positively correlated with a poor prognosis for breast cancer patients, suggesting its potential as a diagnostic marker and therapeutic target for the disease [PMC6854119]. References: - PMC6854119

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUCGUGGUUUCCUGCGUUUGUAGAUGGAAGGAAGAACUUGUGUGCUUAGACCUGACGCUGGGAGGAGAUGCUGCCACCUAGGUUACUUGUAGGACCCUAUACGGCAACCUCCUUUGCCAGGAACUAUUUAUAAACAUCCUGCAGGAAAAUGCAGUGAAGUAGAAGAGACAGGGAUAUCCCAGAAGGUUAUGCAAAACAUCAAGAGAAGAUGAGAGGAGUCUAUAUGUCAGAAUACACAUUUCCCACCUUGCCCAACAGUAGAAAAACAUAAGAAGAGAAAAACAUUAAAAAAUGACAAGGAAGUUAAUGGAAGUCAGCAAUGUGAUGGUGUUUGGAGGUGGAGCCUUCAGAAGGUAAUUAAUGCCCUUGUAAGAAGAGGCCAGAGAGCUUGCGCACCUUCUUCCUGCCAUGUGAGGAGCCAAGAAGCCGGCUGUCUGCAACCUGCAAGAGGACCCUCACUAGAAGCUAGCCAUACUGGCAUCCUCAUCUUGGCUUUCCAACUUCCAGAACUGUGAGAAGUAUAUGUUUGUGGUUUAGUCAAUGGUCUAUGGUAAUUUUUUUAUAGCAGUCCCAGCCAAGACAGUGCCUCAUUUACUACAUACCAUUUAUAUUAUUAUAUAGGCUCCUUUCAGAAACCCAUGUUCAAAUAAGAGAUAAGAUACUGAAACACAUAACACCUUCACUAGUUUUUAGUAUACAAAUAUUGAGAAAUAGUUUGUUAUUAACUAUCUCAUCCAAGAAAUGCAGAUUCAUGUUGUUUCUAAUUUUUUAUAUAUAAUUGACAAAAUGAAGAAACUUAACACCAUCCUAGAUUUUAGCUGCCCAAAGAAUGAAAAGAAUGAAAAAAAAAUCUUUGAAAACCCACAAGUGAUAUGGAUCUAAUUUAUGGUUAAAUAGAUAUAGAUAACAAACAGAAUACGCCUGUUUAAAACUGUUAAAAUGACAUUGGUUCUAAUUAUACUUUUAUUUAAAUUGAAAGACAAGGCAUUUAUAUGGUAUCUCUAACCAUCACAACUUUUGUGUGACAAAAAGAAAUUAUCACCAAAAUACACCUCCUUAAGUAAGUGUCUGAUUUCACACUUCCAGAAAAAGUGCUCUUUCUGGUCAAGCCAGCAAGAAUUGAGAAAGAUUAAGAAAGUGCUUCAAAGAUGUUUAUUAAAAAGUUGUCAUAAAAAUGUGAAGUAGAUGUAGCAUCAAGCAUACCAAAUAAAGUAAAACUGUCAUCAAGAAGAUUCAACAGCUAUGAAAAGAGUUCUUCAAAAUAUGAUAUGUUUUUCUAGAUGAUAAUAAAAUUUAUCAAUUCCAAAUGUCCACAUUAGUCUUUCAUAAAGACACCAAUGAGUCACAGGAAAAAAAAUUAAAAAUAAAAAAACCCUAUCUCAGGGAAUCAUGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications