v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ERICH6 antisense RNA 1 (ERICH6-AS1) URS000075EF00_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ERICH6-AS1: ERICH6-AS1 is a long non-coding RNA (lncRNA) that has been identified as a potential prognostic marker in endometrial cancer (EnCa) patients [PMC9523019]. In a study that conducted systematic bioinformatics analyses, ERICH6-AS1 was found to be one of the 11 NRlncRNAs included in an overall survival (OS)-related prognostic model [PMC9523019]. Furthermore, ERICH6-AS1 was found to have the strongest correlation with immune cell infiltration among the 13 immune-related lncRNAs identified in the study [PMC7893582]. The study also revealed that ERICH6-AS1 is a risk-associated lncRNA in EnCa patients, along with several other lncRNAs [PMC7893582]. The risk score for each patient was calculated using a formula that included ERICH6-AS1 as one of the variables [PMC7893582]. In conclusion, ERICH6-AS1 is an lncRNA that has been implicated in endometrial cancer prognosis and immune cell infiltration. It is considered as a risk-associated lncRNA and has been included in prognostic models for endometrial cancer. These findings suggest that ERICH6-AS1 may have potential clinical implications for predicting patient outcomes and understanding the immune response in endometrial cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUGCGUUGGUCUCCCCGGGCAACUGCUUGCCCUGCGCCACCGAGCCUCCCGGAUUUAAAGCGGCAGGAGCUGGUUAGCCGGAUAGAAUGUAAUCCACCCGCCUUGGCCUCCCAAAGUGCUGGGAUUACAGGUGUGAGCCACCAUGCCCAGCCAGAAACUGCCACUUUUAAACCAUCAGAUCUCAUUGAGAACUCCCUCACUAUCACGAGAACCGCAUGAGGGAAACCACCCCCAUGAUCUGAUCACCUCCCACCAGGUCCUGCCCUCAACAUGUGGGGAUUACAAUUCAAGAUGAGAUUUGGGUCAGGAAACAGAGCCAAACCAUAUCAAGAGCCUCUGGUAACCACUGUUCUACUCAAUACUUCUAUGAGGUGAACUUCUUUGGAUUCCACAUAUGAUCAAGAUCAUGAGGAAGGAGGAGCAAGUCUUCUUUGUCAUGCUAUUAAGAAAAUACCCAGAGUCACAGCACCAUGAUCUCCUUGUGAAGCAGAACAAGUAAUAUAAAACUGAUCUAAAGAGGCCUCCCCUCUACUCUUAUCUGUCUGGUCGAGUCAUUUGGGUCCAAGUGGGCACCAUUGUGGGAGGGUGGGAGGACUCAUCACUGGGGGCCCAGGCAUCAUUGGCAUGUGGCCUCCUGUGUUAGUUUGUUCUCAUGCUGCAAAUAAAGACAACUUGAGACUGGAUAAUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications