v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2593 (LINC02593) URS000075EEDF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02593: LINC02593 is a long non-coding RNA (lncRNA) that has been studied in relation to pyroptosis and cancer [PMC9135526]. In a study, it was found that LINC02593 had a hazard ratio (HR) less than 1, indicating a lower risk [PMC9135526]. The risk score in this study was calculated using six pyroptosis-related lncRNAs, including LINC02593, and its independent predictive ability was confirmed [PMC9135526]. Another study showed that the expression of LINC02593 decreased with an increase in the risk score [PMC8899517]. Additionally, the expression of LINC02593 was found to be less in various cell lines except for Kasumi-1 [PMC8899517]. The specific role and function of LINC02593 in these contexts are not explicitly mentioned. However, it is worth noting that its expression levels were associated with the risk score and varied across different cell lines [PMC8899517]. Further research is needed to fully understand the role of LINC02593 in pyroptosis and cancer progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGAGUGCAGAGCCAGGGCCCAGCACGAAGGCCUUGGGCUCCAGUCCGUGUGCCCCACAUCCCUACAUGAGUGAGGGUGGAGGGAUGGUGCCUCUGCCACGGCCACGGUGCCGCCGUCCACGUCAGCUCACUCUCAGCACAGGUGCUGUGUGACGGCCUCGGGCCACACCGCUUGUUCUGAGGCCCCUAGCAGGUCGGGCUUGUGCUGGCUGCACAUUGGCUGGUGAGCUUGGCGGGUCUGUGGGCACGGAGAGACCAGAACGUGCGUAACAGGCCCGAUGAGGGUGCCAGGCUGUGGCGACCCCCGAGCUUCAGAGGAGAGGGGCACCAGCCGGGGGCCCUGCACAGGCAGCCUCAGAGAGAGGAAAGCUCACGAUCUGGGAGAACUCCAGGCCUGGCCCAGUGAAGACGUCCUUAUCUUCAGCAGACAUUGCCCAGUGCAAGGGGAGGGAUUUUUAGGGCGGCAAGCUCAGGUGGACAGGCAGUUUUAUUCUGUUUCCCAUGUCAAGUCCAGCCCCAGACUGACUUUCUGAGGUCACAGACGGAGCCUCACCCCAUCCAAGGCGGUGUCCUGGACUCCCACUGUGCUCCCCAGAGGGCAGGGUACCUGGGGCCCAGCCCGGGCGGCAGGAGGGACUCAGCCCCUCGCCCAGGCAGGAAGGGUCCCAAGCAGAGGCCCCUCCCUCAGGCACUCCCCAGCCCACACCUGCAGCACUGGGACCAAGACUAAUAAAACACCAGCCUCACGGAAGACAGCUUUAUCUUGUUGAUCGGAAGUCUGCCAGCCCAAUUUAUGAUGGAACAUAAGAUCUCUAAAUCUGAAUUUACGCUCUGUAGCGUAACGAGAGGUCAAUAAGAUUAAACGGGGGCUCAGGAGAGGACCAGCGUCAGGCUCACUGCGAGGUGCUGCACAGAAAACCCACAGCCAGAGCCCCUGGGCCCAGCCCAGGCAAGACCAGAAAAGGAGGGGGCAGGUGGGAGACCAGCCUGGGGCUCCCGGGAAGCCCACGGGAUGGAGGCGGGAGAGCCAGGAGGCCUGGGGCAACCCUGGGACGGUUCCUGGAUCGAGGAGAGCAGGGGGGUGAUGAGGGUUCCCUCAGGGCUGGGGAGCCUUCUCCUGGUCUCAGACCCACCCCCCUUCAGCUCCCAAGCCCUGGGUGCCCCUGGCUCUGAGGACAGUUGGGAAUCUUCCCUGAGGCAGGUUCAAGGACAGAGCUCUGACCCUGGCCCAGGGCUGCUUUGGGUGCCUAUGAACUCGGCUUCUGGCUCAGAGCAGUUCCCUGCACCCCUUCCUGAGCCCUCUGUCCUCUGGAACCCGUGGGCAGGGUGAGGGACGGGUGUUCCUUCUGGGUGGGGGCCUGGGCGCCCAGCCAGCACGACGCUGGCUUGCUGAGCUUAGGGCAGACCCCGACUUCAGAAUUUAUACAAAUAAAUGCAAUGAAAAGUGCUGGCAACCUGAUCUGAUUACAGAGUCAUUCAUUCUCUGGUCGUUAAUAAUUUGUGCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications