Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) UNC5B antisense RNA 1 (UNC5B-AS1) URS000075EE9C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

UNC5B-AS1: To predict target miRNAs for EPB41L4A-AS1 and UNC5B-AS1, an independent bioinformatic lncRNA prediction tool, lncRNASNP2, was applied [PMC10064547]. Furthermore, Kaplan-Meier curve analysis demonstrated that increased expression of LINC01559 and UNC5B-AS1 is associated with a poor prognosis in PDAC patients [PMC7757027].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCCUCCUCAAACACACAUCCAUCCUCCGGCACACACCCAGUCCAUGCCUCGCCCCCACACACACCUGACACCCCAGUGCAACACCACACCCACCCUCCCCUCCCUGCAAACUCCCACCUCCGCCCACCUGCUUAAUACACAUUCUCACCCCCCACACACUCCUUAAUACAUACUCUCACACCCACAAGCCUGCCUUCUUGGAGAAGUGAGCCGAGCCGUGCAGCGCCGCGAAGGGCAUCCCCGAAGACCGGGAGGAACGCCGCGGGGACCUGUGGCUUAGCGCGCUCCGCCCGGGCUUGUCUGCCCGCGGGGGCGCAGCGGCUGAGGCGGCUCCGGGCCGGAGUUCCAAUCAAGCGCCACCCAACUCCCAGUCGGGGGCCGAGGCCAGCGCCGGGAUGCCAGCUUCCCCCAAAAAGAUCCUGCCUCAGGGAAAUGCAUGGAGCCGGCGGAAAAGCCCGCGGCGCCCCCGGCGGAUCGCAGACCCUAAGGGGGCGGGAGGUGGCGCCCCAGUCCCAACCUCUUGAGCCAACCCAGUGGGUGGGAAGUGCCCUUACCCUAGGCCUUCCGCAAAGUGUUCUCUCCUUGUAUUAUUCUAAUUACGGUAUUUUUAAUUUCCUUAAAAAAAUAAGAAACAGAAAAGCACAGAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications