Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) TMC3 antisense RNA 1 (TMC3-AS1) URS000075EE99_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TMC3-AS1: TMC3-AS1 is a long non-coding RNA (lncRNA) that is detected in both nuclear and cytoplasm samples from osteoblasts, unlike the cytoplasmic marker GAPDH [PMC8964444]. In a study, several lncRNAs with biomarker potential in multiple myeloma (MM) were identified, including TMC3-AS1 [PMC6628062]. The study also identified other antisense genes such as FAM83C-AS1, ZNF32-AS1, and TAT-AS1, as well as lincRNA genes like LINC00863 and LINC01123 [PMC6628062]. Additionally, primary miRNA genes such as MIR301A and MIR378H were also identified [PMC6628062]. The data from another study suggest that TMC3-AS1 may play a role in the transcriptional regulation of inflammatory genes in cells stimulated with lipopolysaccharide (LPS) [PMC7387720]. Knockdown of TMC3-AS1 has been shown to negatively regulate the expression of IL-10 and decrease the expression of A20, CCL11, IL-8, and TNF-alpha in SW480 cells [PMC7387720]. These findings highlight the potential importance of TMC3-AS1 in various cellular processes and its potential role as a biomarker for MM.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGACGCCUUGGGCGGGCCGGGUAAGGUCCAGCCGUAUCCGCCUCCUUCAUGUCCCGCUGUGGGAGGGGCUCUGGAGCGCCGGGACUGUGAGAUGGCCAAUGACGGUCUGACCCGUUGGGCCGGGCCAGGUCGCGGACAACGUCGACCGUUUGUUUAAGAAGCGUGGACUCUUGUCCUGAGUGCACCGAGGCUUUCAGCCUGCGGGACAGUGGUGCGAUUUGCAUUAGAGAAAGGGAGAUGCCAUGUGCUGGCCCAGCACUCCAACAGGGGCCUGACCUCUAGGAACGGGACACUGGAGGAAGCCUAGACAUCUGAACAAAUCAAGUCAUCCAGAUCCACGGUCAGCUCCUGCCCCGACUUGGCCUUCCUCCUGCUGGGCUGGCCCACGGACCUCGGGAACCUGCCCUGGCUGUGGGUGACCUGCAGCCUAUCUCCCAGGACUAUGGAAGCCCCAUGCAGGAACAUGGUUCUGACACUUUGGGGAUUAUACCCUAAGCUUAAAGGACUGGAAAAGCCCCUGAAGUCCCGAGACCACAACCCUCCACCUUCUAAAGAUAAGACAAGUCACUGAAGGUCUCAGAACUGUGGCCCAUUCACCCCUUCCCUCAAGACAAGAGUGUGGCCAAGCAUCAAUCUCACCCCCAGAGACCAGACGGUGUCCAGGUCUUGGGCAGACGAAACCUGCUCCUUGGGGAUGGUCUUCCUGGCUGUGCUUCCAAAGGGCUGGCCUGCAAUCAGCUGGUUUUCACUUGAUCCUUUCGGGGUUUGCAUUAUAUCUGACUGAAGGAAUGAACUGGGAGAGAACAGCAGAGCCGCAGCGGAAUGUGGAAAGGCCCACGUCCAGACUGUUCCCAUUCUGAUUUAAAAGCCUGAUGAAGGAACAGCUGAACUCAGAGAAACAGCAGACUUUGAGAAGCACCAGUGUGGAAGACAUUCUAAUAUCUCCUGACUGUACCAAAUUGGGAGCCUAUAGUUAAUUGUGUAGUUAAUUGUAUUCCAAAAUACUCAUUUGGAAGUCAUUUGGUAAGAAAUUCACACAUAAAAAAAGGUUAUGCUAGCAAAUAACAGAUGAAAUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications