Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) SP2 antisense RNA 1 (SP2-AS1) URS000075EE8D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SP2-AS1: SP2-AS1 is a long non-coding RNA (lncRNA) that has been found to have regulatory relationships with has-miR-204-5p [PMC8688464]. However, the mechanisms and biological functions of SP2-AS1, as well as other lncRNAs AC087501.4 and AC090541.1, have not been studied in cancer [PMC9542578]. In a test set, LASSO-Cox regression was used to identify prognostic lncRNAs, including SP2-AS1, AC087501.4, and AC090541.1 [PMC9542578]. These lncRNAs were used to construct a prognostic model and calculate the risk score [PMC9542578]. In another study, SP2-AS1 was found to be regulated by differentially expressed miRNAs along with other lncRNAs [PMC9441417]. Additionally, in the context of prostate cancer (PCa), SP2-AS1 was identified as a potential protective factor with a hazard ratio (HR) less than 1 [PMC8672116]. Furthermore, SP2-AS1 was included in a ceRNA network along with other lncRNAs and miRNAs that interacted mutually in various pathways [PMC8672116]. In blood samples related to endometriosis and cervical cancer of the ovary/endometrioid type (CCOC), the expression of SP2-AS1 was associated with risk [PMC9040176]. Finally, gene alterations involving CDK5RAP3, SP2-AS1, and other genes were observed in relation to PNPO alterations [PMC8814662], with these alterations being more common in the altered group compared to the unaltered group [PMC8814662]. References: [PMC8688464] [PMC9542578] [PMC9441417] [PMC8672116] [PMC9040176] [PMC8814662]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGGGGCGGGAGCAGAGAGACAAGGAAAUGCUGUCACCGCGGUUAACACGCACGUGGAGGUUGGUUAAAGGGAAGACCUGGGUUUUAGUCCUGUCUCCAUCAACCUCAAGAAAUGGGACCUCAUGGAAGGGAGGGGAGGCAAUGCCGAGGAUGUGCUCCUGAGCAGGUGCCACAAUUCUUCACCUGUAAGGCUGAUCUAAGAAGAUUCCUAAUUAUCAAUUGAGAGCAGAGAUAUUCCACUUCCAAUUACAUGGCCUGCCUGCUCACUCUUACUUCCUAUUCACACUCUCUUGGAGACCACUUUGUGAUUCUACCAAAUUCUAUAGGAGAGGUGACAACCCCAAAGAGAAGGCUCUAGAAAGAUGACAUUUGGAAAUGUGUACGCUAGUGUCUGCUGGCUCCUCCUGAGCCAUUUUUACUCUGUGAAUGAGAUCAAAGGCCACCUAACUGCCUAAAUCACCACAAAGGGACAAACUGGUAUCUCAGAGCACUCAGCAACAAAAACAAGAAAGCUAAGCCUCUGCACUGCAAUGUGGCAGGGCUUCUGGCUAAGUAUAGCAAGCAAUUCUGAUGUGGAGACAAACAGCAGCAAUGGGAAUGAUAUGCCAAUGAAGGAUUCCAACAGUUGGGUCUGCAAGUGUGCUUGUCCUGUGACACAAACGGCCUAGACAUCUCAGCACUGCUUGGAGCUGCUCAUUGGGGGAGCCUAAGAAACAUCAGCCCUUUCACAACCUCUUGCUCCUGAGCAGAGCUCAUCUCCCAAGAGCACAUCAGCCCGCAGCCCAGUCUGAUGAGAAGCACAGUAUUCCCCUGUGCCAGUGGCAGCCUCAGAGCAUCCUGAAAGAGCGCUUCCUAGACACGCAGUGGAAGCCAUGACUUCCCCUAAGCUGCCGGUGCUGCCUCUGAACUCAUGUGGAGGUUCUUUUUUCAGUGUCCCCAGAGGCAGCAGAAAAAUCCGUUUUCCAUUUUGGAAUCUAUCAAGUAGGACAAAUCUGCCACCUGGGAGCAUCUCCUCAAGGGCAAUCUCUGCUCCCUUUCCUACAUGGCCUGACAAUACCCUCGAGUUAGAAAUGUCCCAUGUUGGCUAGGCACAGUGGCUCAUGCCUGUAAUCCCAGCACUUUGGGAGGCUGAGGUGGGAGGAUUGCUUGAGGCCAGGAGUUUUGAGACCAGCCUGACAUAGAGAGACUAUGCCUCUAUUAUUUUAAAAAAAGAAAUGUCACAUAUUUUUACCCUCUUCACUCAUCUUUCCACCUUGCUCCAAUAGAUUGCUGACAGAAAAGUGAGACCUCCUCCACCCCAAGGUCUCCUAAGAGAAUGCUGCUAGCCAAAAAAAGAUCUGCUGAUAAUUGAGGAAGAGCAUCUUUAAAAAGACACUCAACUACAUUUCAGAAACAUAAAGAUCUAAGUGUUGGCUCUACAAGGGAAGAAAUAAAGAGAAAGAACUUUUUUUCCUCCUACAACAGGUCUAGACAACGUCAUACAAGGAGUUGCACGCAUAUCCAAAACAAAAGCAAGGCAAAAACAAGCAAAAAAGCAACAAAUGCAUUCCAAAAUGAUGUCCAUUUAUCAGCCCAGAAAUGUACUGGAUACUGGUUUAGUUCAGCCUGUAGGUGCUGGGAAGAAAUUCCGACAAAUCCAAGUCAGUUGCAAAAAGGGAAAACUCCAGACAUAUCACCCAAUGAACUUGUAAGAAAGCAUAUGAGCUUCCCUGAACAGAUUUUACUCCAGGUUUGCAGCCCGCAAGAUUUAAGAUGGGGCCAUGAGGUUAAAUCUUGUAAACUCAGAAGUGUUCACGCUACUGCAUCCCUAAACUCUGUAACUCUCUACAUACUCUUUAAAGCAGUGUUUCUCUGCAUCUUUCAUUCCAUAGCCAUUGUCCACCUGAUCCAAAAUAUCCUAAGUUUUUCAGUGUUUGGAAGCAGGGUUUCCAAUUUUUGUGUAUACAGAAAAGGGGGGUGUGUGUGAAAAAAUAAGUAUUAGAAAAAAAACAUGUUAUACAUAUCUAUCACAGAAAUGAGUGGGCAAGGUUUAGAAGAUGGCUGAAACCAAGCCAAUACUAAGGUCUACUGGUUGGCUGCAACAAGUUUAAAAUGUCUUCAUAAGGGCCCUGGUUGGGCAAUACUAUACUUGCUGACAGUACUUGGGAUCUGCCACAGACCUAUAGCAAAGGACUGUUCAACUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications