Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-425 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-425 precursor URS000075EE47_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR425: MIR425 is a differentially expressed (DE) microRNA (miRNA) that has been studied in various biological contexts. It has been identified as one of the DE miRNAs in calf and bull testes, along with MIR98, MIR34C, MIR184, MIR18A, MIR136, MIR15A, MIR1388, and MIR210 [PMC9777600]. In breast cancer cells, it has been shown that the long non-coding RNA LINC00899 directly interacts with and binds to MIR425 [PMC6914403]. In the context of breast cancer cases versus controls, the ratio of microRNA concentrations for MIR425 was found to be downregulated in serum samples [PMC9967215]. Additionally, it has been identified as a potential biomarker for breast cancer along with other miRNAs such as MIR21 and MIR155 [PMC9967215]. In tumorigenesis regulation studies, both in vitro and in silico approaches have implicated the involvement of miR425 [PMC5361868]. Furthermore, studies have shown that homozygosity for a deletion involving the gene encoding for miR425 is lethal in mice [PMC8520725]. In other cancer types such as cervical cancer and gastric cancer cells, miR425 has also been implicated as a potential biomarker or regulator [PMC8316837] [PMC7238808]. Additionally, it has been proposed as a potential biomarker for pancreatic ductal adenocarcinoma (PDAC) detection along with other miRNAs such as miR31 and miR93 [PMC9599289]. Furthermore, downregulation of miR425 expression has also been observed in hypertrophic cardiomyopathy and myocardial infarction cases [PMC8773242] [PMC9897690].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGGAAUGUCGUGUCCGCCCAGUGCUCUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications