Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-124 precursor (hsa-mir-124-3) URS000075EDDE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR124-3: MIR124-3 is a conserved microRNA that has been found to inhibit invasion and migration of malignant cells in ovarian cancer and hepatocellular cancer [PMC6712160]. It is one of three members of the Mir124 class, along with Mir124-1 and Mir124-2, located at different genomic positions [PMC6346295]. MIR124-3 has been shown to be hypermethylated in tumor samples, with a 16-fold difference in methylation compared to control samples [PMC8656781]. Hypermethylation of MIR124-3 has also been associated with shorter overall survival in ovarian cancer patients [PMC8835734]. Methylation levels of MIR124-3 have been found to increase significantly in primary ovarian tumors and peritoneal macroscopic metastases compared to control samples [PMC8835734]. Additionally, MIR124-3 methylation has been associated with the onset of ovarian cancer pathogenesis [PMC8835734]. MIR124-3 is one of three genes that encode the same mature miR-124, with the other two genes being MIR124-1 and MIR124-2 [PMC4861808]. It has also been found to be methylated in patients with borderline personality disorder (BPD) [PMC6252387] and is involved in neurogenesis [PMC7686352]. Furthermore, MIR124-3 is one of four microRNA genes identified as having anti-tumor roles in pancreatic ductal adenocarcinoma (PDAC) [PMC9599555]. CpG islands located in the promoters of all three miR-124 precursor genes (MIR124-1, MIR124-2, and MIR 24 - 3) have been selected for analysis due to specific criteria being met. However, it remains unclear whether the upregulation of miR-124 is directly related to the hypomethylation of the precursor genes [PMC8724533].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGGGCCCCUCUGCGUGUUCACAGCGGACCUUGAUUUAAUGUCUAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGGCGCCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 38 other species

  1. Aotus nancymaae miRNA (ENSANAG00000002800.1)
  2. Bos grunniens (domestic yak) microRNA 124-3 (ENSBGRG00000019491.1)
  3. Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000003719.1, ENSBIXG00005003412.1)
  4. Bos taurus microRNA bta-mir-124b precursor
  5. Callithrix jacchus miRNA (ENSCJAG00000045768.2)
  6. Capra hircus microRNA 124-3 (ENSCHIG00000009530.1)
  7. Cebus imitator microRNA 124-3 (ENSCCAG00000018609.1)
  8. Chlorocebus sabaeus (African green monkey) microRNA 124-3 (ENSCSAG00000023382.1)
  9. Cricetulus griseus (Chinese hamster) miRNA (ENSCGRG00015016122.2)
  10. Felis catus microRNA 124-3 (ENSFCAG00000043856.1)
  11. Gorilla gorilla gorilla microRNA 124-3 (ENSGGOG00000029795.2)
  12. Loxodonta africana microRNA 124-3 (ENSLAFG00000025035.1)
  13. Lynx canadensis (Canada lynx) microRNA 124-3 (ENSLCNG00005010218.1)
  14. Macaca mulatta (Macaque) microRNA 124-3 (ENSMMUG00000038287.2)
  15. Macaca nemestrina miRNA (ENSMNEG00000004669.1)
  16. Meriones unguiculatus (Mongolian gerbil) miRNA (ENSMUGG00000000124.1, ENSMUGG00000006470.1)
  17. Microcebus murinus microRNA 124-3 (ENSMICG00000018824.3)
  18. Moschus moschiferus (Siberian musk deer) microRNA 124-3 (ENSMMSG00000021387.1)
  19. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000020582.1)
  20. Nomascus leucogenys microRNA 124-3 (ENSNLEG00000021662.2)
  21. Otolemur garnettii miRNA (ENSOGAG00000032077.1)
  22. Ovis aries (sheep) microRNA 124-3 (ENSOARG00020005110.2)
  23. Panthera leo (lion) microRNA 124-3 (ENSPLOG00000016654.1)
  24. Panthera pardus (leopard) microRNA 124-3 (ENSPPRG00000013979.1)
  25. Pan troglodytes miRNA (ENSPTRG00000051586.1)
  26. Papio anubis (olive baboon) miRNA (ENSPANG00000018320.3)
  27. Pongo abelii miRNA (ENSPPYG00000021908.2)
  28. Pongo pygmaeus microRNA ppy-mir-124 precursor (ppy-mir-124-2)
  29. Procavia capensis (cape rock hyrax) miRNA (ENSPCAG00000019589.1)
  30. Prolemur simus (greater bamboo lemur) miRNA (ENSPSMG00000016889.1)
  31. Propithecus coquereli miRNA (ENSPCOG00000000596.1)
  32. Rattus norvegicus (Norway rat) microRNA rno-mir-124 precursor (rno-mir-124-3)
  33. Rhinolophus ferrumequinum (greater horseshoe bat) microRNA 124-3 (ENSRFEG00010016832.1)
  34. Sciurus vulgaris microRNA 124-3 (ENSSVLG00005003876.1)
  35. Sus scrofa microRNA 124-3 (multiple genes)
  36. Urocitellus parryii microRNA 124-3 (ENSUPAG00010009769.1)
  37. Ursus thibetanus thibetanus microRNA 124-3 (ENSUTTG00000016580.1)
  38. Zalophus californianus miRNA (ENSZCAG00015013300.1)
Publications