Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) ZNF295 antisense RNA 1 (ZNF295-AS1) URS000075ED2C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

ZNF295-AS1: ZNF295-AS1 is a long non-coding RNA (lncRNA) that has been implicated in the pathogenesis of epithelial ovarian cancer [PMC7168724]. In a study, the enrichment of pathways associated with ZNF295-AS1 was found to be zero, unlike other lncRNAs [PMC7168724]. A lncRNA-miRNA-mRNA network was created, which included ZNF295-AS1 and other lncRNAs, miRNAs, and mRNAs [PMC7168724]. The expression levels of ZNF295-AS1 and other co-expressed lncRNAs were detected using qRT-PCR to validate RNA-seq data [PMC8005612]. ZNF295-AS1 was identified as a differentially expressed lncRNA in ovarian cancer using miRcode analysis [PMC7377077]. Based on the role of ZNF295 as a transcriptional repressor, it is suggested that ZNF295-AS1 may be involved in the regulation of gene expression related to tumorigenesis [PMC5747377]. ZNF295-AS1 was identified as one of the interesting candidate lncRNAs for further analysis based on its features such as fold difference and gene locus [PMC4121291]. The expression levels of ZNF295-AS1 were found to be up-regulated on promoters in liver cancer cells mediated by HBx-mediated H3K9me3 enrichments [PMC5356706]. In a study investigating ceRNA networks associated with gefitinib resistance, MIR137HG and ZNF295-AS1 were identified as promising lncRNAs associated with gefitinib resistance in lung adenocarcinoma cells [PMC9477152]. The expression pattern of MIR137HG and ZNF295-AS1 showed similarity to FZD4 in the ceRNA subnetwork [PMC9477152]. ZNF295-AS1 was found to be down-regulated in glioma and associated with glioma grade and survival [PMC9980576]. Additionally, ZNF295-AS1 was found to be down-regulated in a study on colorectal cancer [PMC9436424].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUCUCUCCGGUCCCCAGUGCAUGGGCUGGAGUGUGGCCCCUGGCAGAGCCCUGGAGGCCGGCUCUGCUUCCUGCCCCCUUCCAGCCUGGAGCAGCCCGAGGGCGCAGCAUUCCUGGGGCAGGCCUGAGCCCUGUGGUGGGCUGAGUUGAGUCCCCAGAAAGGAUCUAUGAAAGAUAAAAUGUGGUGUGAGGACACGGCCCAGCCCCACCGUCGUCUUCCAGCCCCACCAUCGUCUUCCAGCCCCACCGUCGUCUUCCAGUCCCACCGUCGUCUUCUAGCCCCACCAUCGUCGUCUUGGACUCUCUGGGUGGCACCACGCUGUGGGUGCUGCUCUCCUCUGUGUCCCAAACGAGUUUGUGCCUCACUUUGUCGGGUUUUGGCUGUGACUUGGAGCCUCACCAAGCUCCCUUUUCCUCUGUCUCCCAUUCUCCUCUCCAGGCCAGGGUGGCUUCCCCAGCCCUCCUCCCCGGGUCCUGCCUGUGCCGAGCCUUCCUCCCAGGAGGGAGGUGAUACUGACUUGAGAUCUUAUGGGUGUUUUGUUUGUGGCUGGGCCUGGCCGACCCUCUCUCCACGGCCUUAGAUCACACUCUGGAUGGAUAGGACAGUCGUCCUCAAUACUGAGCCUCUUUGGAGCAUACCCACUGAUGGUGGUUCACAAGCUACCCACGCCCACAGGCUGACCCAGAUCUCCGUGAAAUUAAAAAAUACUGUGAAAGGAAAAAGAGCCAAUGUCAUGUGGAUAAUGAAGUGUCAGCCACUGAAAAAUCUCAAAAUAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications