v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) prostate cancer associated transcript 14 (PCAT14) URS000075EBBE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

PCAT14: PCAT14 is a long non-coding RNA (LncRNA) that has been investigated for its potential impact on endothelial cell migration, sprouting, and inflammatory responses [PMC9634578]. A study was conducted to explore the relationship between PCAT14 and the clinical characteristics of prostate cancer and immune cell infiltration [PMC8741340]. The study aimed to determine whether PCAT14 is associated with prostate cancer and its potential role in immune cell infiltration in the tumor microenvironment. The findings of this study could provide insights into the role of PCAT14 in prostate cancer progression and immune responses. The investigation focused on understanding how PCAT14 may influence endothelial cell migration, sprouting, and inflammatory responses, which are important processes in tumor growth and metastasis [PMC9634578]. Additionally, the study aimed to determine whether PCAT14 expression levels are associated with clinical characteristics of prostate cancer patients, such as tumor stage or grade [PMC8741340]. By examining the relationship between PCAT14 expression levels and immune cell infiltration in prostate tumors, this research could contribute to a better understanding of the tumor microenvironment's influence on disease progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAUACGGCCUCGUGGGAAGGGAAAGACCUGACCGUCCCCCAGCCCGACACCCGUAAAGGGUCUGUGCUGAGGAGGAUUAGUAAAAGGGGAAGGCCUCUUGCAGUUGAGAUAAGAGGAAGGCCUCCGUCUCCUGCAUGUCCUUGGGAAUGGAAUGUCUUGGUGUAAAACCCGAUAGUACAUUCCUUCUAUUCUGAGAGAAGAAAACCACCCUGUGGCUGGAGGGUGAAGGUACUCUACAGUGUGGUCAUUGAGGACAAGUUGACGAGAGAGUCCCAAGUACGUCCACGGUCAGCCUUGCGACAUUUAAAGUUCUACAAUGAACUCACUGGAGAUGCAAAGAAAAGUGUGGAGAUGGAGACACCCCAAUCGACUCGCCAGUCUACAGGUGUAUCCAGCAGCUCCAAAGAGACAGCAACCAGCAAGAAUGGGCCAUAGUGACGAUGGUGGUUUUGUCAAAAAGAAAAGGGGGGGAUAUGUAAGGAAAAGAGAGAUCAGACUUUCACUGUGUCUAUGUAGAAAAGGAAGACAUAAGAAACUCCAUUUUGAUCUGUACUAAGAAAAAUUGUUUUGCCUUGAGAUGCUGUUAAUCUGUAACUUUAGCCCCAACCCUGUGCUCACGGAAACAUGUGCUGUAAGGUUUAAGGGAUCUAGGGCUGUGCAGGAUGUACCUUGUUAACAAUAUGUUUGCAGGCAGUAUGUUUGGUAAAAGUCAUCGCCAUUCUCCAUUCUCGAUUAACCAGGGGCUCAAUGCACUGUGGAAAGCCACAGGAACCUCUGCCCAAGAAAGCCUGGCUGUUGUGGGAAGUCAGGGACCCCGAAUGGAGGGACCAGCUGGUGCUGCAUCAGGAAACAUAAAUUGUGAAGAUUUCUUGGACAUUUAUCAGUUUCCAAAAUUAAUACUUUUAUAAUUUCUUACACCUGUCUUACUUUAAUCUCUUAAUCCUGUUAUCUUUGUAAGCUGAGGAUAUACGUCACCUCAGGACCACUAUUGUACAAAUUGAUUGUAAAACAUGUUCACAUGUGUUUGAACAAUAUGAAAUCAGUGCACCUUGAAAAUGAACAGAAUAACAGUGAUUUUAGGGAACAAAGGAAGACAACCAUAAGGUCUGACUGCCUGAGGGGUCGGGCAAAAAGCCAUAUUUUUCUUCUUGCAGAGAGCCUAUAAAUGGACGUGCAAGUAGGAGAGAUAUUGCUAAAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications