Bos taurus (cattle) microRNA bta-mir-365 precursor (bta-mir-365-2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-365 precursor (bta-mir-365-2) URS000075EB6E_9913

111 nucleotides
4 databases (ENA, Ensembl, miRBase, RefSeq)
Found in 7 other species
36 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

AGAGUGCUCGAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUUCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCAGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 7 other species

Bison bison bison microRNA 365b (ENSBBBG00000016881.1)
Bos grunniens (domestic yak) microRNA 365b (ENSBGRG00000015908.1)
Bos indicus x Bos taurus (hybrid cattle) miRNA (ENSBIXG00000008324.1, ENSBIXG00005018760.1)
Bos mutus (wild yak) miRNA (ENSBMUG00000010642.1)
Capra hircus microRNA chi-mir-365 precursor
Ovis aries (sheep) miRNA (ENSOARG00000025130.1, ENSOARG00020011113.2)

Publications