Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1315 (LINC01315) URS000075EAC2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01315: LINC01315 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including colorectal cancer (CRC) and breast cancer. In CRC, exosomes derived from CD133+/CD44+ cells transfected with sh-LINC01315 and LINC01315 were used to treat SW480 and HCT116 cells, suggesting a potential role of LINC01315 in CRC progression [PMC9161962]. The mechanism by which LINC01315 regulates β-catenin transcription was investigated using a pull-down assay, which revealed that LINC01315 interacts with β-catenin in CRC cells [PMC9161960]. The binding sites between LINC01315 and miR-876-5p or between miR-876-5p and GRK5 were predicted and cloned into plasmids to establish wild-type vectors [PMC9161853]. Ablation of LINC01315 was found to stimulate cell proliferation in CCK-8 assays [PMC9328180]. LINC01315 has three isoforms (NR_120595, NR_120596, NR_120597), which can be recognized by specific primers [PMC8524084]. In triple-negative breast cancer (TNBC) cell cultures, including MDA-MB-231, HCC1806, BT-549, and SUM-159 cells, upregulation of LINC01315 was observed compared to normal MCF-10A cells [PMC9161853]. Additionally, four upstream lncRNAs were identified as potential candidates for further study [PMC9526548]. The effects of LINC01315 on colorectal cancer cells may be associated with colorectal cancer stem cells [PMC9161962]. Furthermore, the prognostic effect of LINC01315 has been observed in Her2-negative or Ki67-positive breast cancer patients [PMC8524084]. Overall, these findings highlight the potential significance of LINC01315 in cancer biology and its potential as a therapeutic target or prognostic marker in CRC and breast cancer.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGAGGGCCAGAGAAAGGGAGAAGGGGGUGGGGGGACAGCCACGUGGCCGCAGGAGGAUUUACAACAUUUUCUUUCGCCAUCGAUGUUAUCGCAAAAUGUGUGAGAGAAGCGGCUGCGCAGCCCGGACGGGAGCGUGAGGGUGCGGGCCAGGUAAGCAGCCCCGGCGGUUUCGCCGCAUACGGGACUGCGGGGCGACCGCGGGCACCAGCCACGCGCAGCGGCUCCGCGGGGUCUCGGCCGGGUCCGCGCUCUGAAGGAUCUCGAGAGCCAUGGAUGGUGCAGGCGGGACCCUCGAGCUGCAGCAUCUCCGGUGACCCGGGGUUGCCGAGGAGGUGGAGACCAGCACAGGUGGUCCGGCCCGGGCGCCUCCGAAUCCGGGGGUGGUCAAGACGGAUCCCCAAGGCUGAGGUCGGCAGUCCCGGGGACUCGCAGCUGUUGAGCCUGUGGAGACGCGGCCCCGUGACCGAGGCACCCUUCAGCAACCCGGGGGCAGCGUUCCAGAGACUGAACUUCUCAAAUCACUGCUUCAACAGCUUUUAAAAAUCUGGACCUAGUUACUCCUGUCAUCUAUGUGUAAAGAUUUAGAAAAAAAAUCCCAAACCCAAGGGUGGGCAGCCGCGAGGAUGUACAGCUCCUGGCAGUGUGCGCUCACCCGGAGACCUGAGGUCAAAGCCCAAAUGCUGAGCACCUCCUGGGAGGCGGGAGCAUGGUCUGCUCAGUGCCAGACAUCUGGAUAUUGAGAAAACAUCUGGGUAGCUGGGGUUUUCAGGUUUCUGCCUGACAUUUAAUAUCACAAACAUUGAGCCUGCUCCUGUCCCCCACCAGCCACGCGGCUUCUCCUCCCAAACAUACCCAGCUCCUUCCCCUGCCUUCCUGACGGGUAAGAAACAUCCAUUCUUUCCAAUUCCCCAGCGUUUUCCCCCUACCGGAAAUCUGAUGGGCUUAUGACAUCAUGGCUGGCUGCUGAGCGAUGAAGUGGAUGCCACAAAGAAAUCCGACAUAUCAGAUAGAUUCUGAAAUCGGUUUCCCUCCAGCUGUAGUAACAGGCGUGAAGUCAGGAGAAUUUGAGCUUUGUUUAAAAAAUAAAUAAAUAAAUAAAUAAACCAUAACAAAGUCUUGCCCUGUAUUAAAUGCAAUUUUCUUAAAAACAAGCAAACCUUUUGGACAUCAUUUUAUUUUAAUAGAAAUGCUGAGUUUUAUGAAACUAAAGUGGCUAAUAAAUCAGACCUGAAGCUUUGAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications