v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) mir-497-195 cluster host gene (MIR497HG) URS000075E9D2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR497HG: MIR497HG is a long non-coding RNA (lncRNA) that has been found to have a similar expression profile to miR-497 in both clinical glioma tissue and glioma cell lines [PMC8548781]. In a study, an interaction network was identified, which included 11 lncRNAs (LINC00893, AC005034.3, COX10-AS1, MIR497HG, LINC00894, AC015813.1, AP000424.1, MIR17HG, LINC00667, LINC00662 and SNHG3), 35 miRNAs and 59 mRNAs [PMC7364483]. This network provides insights into the potential regulatory roles of MIR497HG in glioma development and progression. The study suggests that MIR497HG may interact with other lncRNAs and miRNAs to modulate the expression of target mRNAs involved in glioma pathogenesis [PMC7364483]. The specific functions of these interactions are yet to be fully understood but may contribute to the dysregulation of key cellular processes in glioma development [PMC7364483]. Further research is needed to elucidate the precise mechanisms by which MIR497HG influences glioma progression and its potential as a therapeutic target for this disease [PMC8548781]. Understanding the role of MIR497HG in glioma may provide valuable insights into the molecular mechanisms underlying this complex disease and potentially lead to the development of novel therapeutic strategies [PMC8548781].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGCUGCCUCUCCCGCCGAGUUGGAGACGGAUGGGCUGGGACGGGUUUUGGGGGGGUGUCCCCAAUUCUGACUGGGAGUGGAGGAACCCCUCCUGAGAUCUCUUGUGGGGGUGCCCCCUCCCCAGGGCACUCCCCAGUCCCUGAGCCAGCCGAGAGGAAGGAGGCCAGCGAUGCGACUGGGGCGGCUCCUUUCUCCUGCACCCCAAAUGUGAGGGAUGCACCCUAAAUUUUGCUCUUUUCAAAAUAGGGGACCAGGAUCUCAGGGGAGAGUAGCUGAGGCCUUGCUCGGAGUCCCAGGAGAUCCACAGGUCCGGCAUGAACAGUGAGAGGUCAGAGGUGGAAGGCUCAGCAGGAGAGGAGAGGAGGAUCAGCAGAGGUCAUGAGAAGGCCAGAAUCCAGGGUCAGGCUGUCUGGAACAGGAAGUAAAAUGGGCCGAGAUGGAGCGAGCCCCCAGUGUGCUUCCAAGGCCACUCCCACCUCCCUGAAACACCCUGCUACGUACUGAUCCAAUGCCCUGCGCUGUGUAUGAGAGCACCUUCUCUUCUGAAACCCCUAUACAAGGGAGGGGCCCCUGCGGAGACCGUGCCCUGCCAUCCAGUCCUCAAGGGGAUUCUAAAAAACUAGUGACAAAGUAGGGAAGCAGCUGAGCUGGAAAGGAGUUCUGAGGACGAUGGAACCUUGGGUAAGGAGGAAGAAGGCUGCCCACCCGCCCUUUUCUGGCAGCCACCCUCCCUCACACUGUCCGUUCCUUGAUGACACAGCUGAUGUGAUUAAGAUCGUCCCCAAAUCGCUUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications