Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-122 precursor URS000075E935_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR122: MIR122 is a liver-specific microRNA that plays a role in various biological processes, including liver metabolism, viral replication, and hepatocellular carcinoma (HCC) development [PMC7352235]. It has been shown that ADAM10 processes surface c-Met and mediates c-Met ecto-domain shedding, and the effects of MIR122 on the release of soluble c-Met were studied [PMC7352235]. MIR122 is involved in the regulation of hepatic gluconeogenesis and lipid metabolism through HNF-4α [PMC4806913]. Reduced MIR122 function leads to promoter methylation and decreased SOCS3 expression, which is not a direct target of MIR122 [PMC3434395]. HAV-RNA replication does not require MIR122 [PMC7165973]. The inhibitory effect of apigenin on HCV replication is possibly explained by decreasing the levels of mature MIR122 through the inhibition of TRBP phosphorylation [PMC5812025]. Incorporating the target sequence for MIR122 in the 3'untranslated region of the E1A gene can reduce virus replication in normal hepatocytes [PMC7281331]. MIR122, miR34a, and miR379 can be used as markers for early detection or monitoring NAFLD development [PMC9738374]. Deprivation of arginine or combination therapy with sorafenib and drugs that enhance MIR122 expression may be useful for managing HCC with reduced MIR122 expression levels [PMC4480756]. The expression levels of molecules including MIR122 were higher or similar to control cells in Vero/MIR122+SRBI+ApoE cells compared to Huh-7.5.1 cells [PMC4916372]. AKT3 absence partially reproduces effects induced by MIR122 expression but is not sufficient to fully reduce tumor size in BCLC9 cells [PMC5342080].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Publications