v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 462 (LINC00462) URS000075E928_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00462: LINC00462, a long non-coding RNA (lncRNA), has been reported to be associated with cancers, particularly pancreatic cancer [PMC7817238]. Previous studies have identified AP002478.1, GACAT3, and LINC00462 as lncRNAs related to cancers and recurrence-free survival (RFS) [PMC7817238]. In pancreatic cancer, the aberrant expression of LINC00462 has been found to be linked with the disease [PMC7767998]. Moreover, high levels of LINC00462 have been associated with a poor prognosis in pancreatic cancer patients [PMC7767998] [PMC7767998]. Furthermore, it has been observed that ectopic expression of LINC00462 leads to a significant decrease in miR-665 levels [PMC5999603]. Conversely, knockdown of LINC00462 results in a marked enhancement of miR-665 levels [PMC5999603]. These findings suggest that LINC00462 plays a role in cancer development and progression, particularly in pancreatic cancer. It may serve as a potential biomarker for prognosis and therapeutic targeting. Further research is needed to fully understand the mechanisms by which LINC00462 influences cancer progression and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCAUUGCUCUUCCUUCAUCUUCCACCAUGAUUAUGAGGCGUCUCCAGCCACAUGGAACUCUUCUUCCUUUAGGUUAACUCCCAUGAAGAGCUUUGAAAGAAAUAGAAGGAUAUUACAUCCUCUUGGAUCAGUCUUGCAAAUGGAGAACCUGCUCUCUGGGAGAAAAGUCAAAUCGGUCCCACGGCUCUCUUCUCCCACUAAGAACAACUGGUUCCUUCCUUCAGAAGAAGAUGUGUUAUUCCCACCAGUAGUGGUGAGCGCCUGGAUUCCAAAAGGGUUAAGAAUUCGGAGAUGUGACCUGCCUCAUUCUGAAGAACGUGGCCCAGCAUGUGUAUGAAGCAAUUAAUUGCUCCACAAACCCUGAAAAUUUGAUCACUGGCCAGAGUAACGCUGAGGAGCCAUCCUGUCUUCUGCUUGAGUGUCUUCACUCUGGGGAUUCUGGCAGGCUGGUUUCCUGGCCAGAUGCUUCUCAUCCACACCUGUGGACCUCAGGAAACCAAAGGUGACCUCUGUUGGCAUGGCCUUGACUUCCUUUCCACCAAUGCCCAUGAGAUGUGGAAAUUGAGCGAACAUCCACACCAGAACCAUACACUCAAACAAGCAGGUUGGGGCAGGGAAACUCCAUCACAUCAUGGUGAGGCAGAGAUGCUGCAGCCACCCAGAUCAUUGUGUAGUAGAGGUGGCACCAUUUUACUAUGUGUCCUCCCUGCACUCAGUGAAGUCUGUGAAGGGAGGGGUCAGUGCAGCAAGGAGCUCGCUCUGCCCCAGAGGAGAGAGUGGAAUGUUCGAGGACACAUGAAAGCAGUUACUCUGCCUACCUUUUAAAACUCUUUCCUCCUGGGGAACUGGUUUAUUCUGUACUCCUAAACAGACUAUAUCCAUGUAUUCACUCCUUCUAUAAAUAUUUGAGAAAAACCUACUAUAUGCCAAGCACUUUUCUAGGCAAAGGAAAUGCAAUAGCCCUUUCUUCCCAUAGCUUCCAGCCUGGUGGGGAAUAAAGGAAUUAAAUAAGCAAUUACAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications