v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) LMO7 antisense RNA 1 (LMO7-AS1) URS000075E914_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LMO7-AS1: LMO7-AS1 is a long non-coding RNA (lncRNA) that has been identified in various studies as a potential biomarker for different types of cancer [PMC8904995]. In colorectal cancer (CRC), LMO7-AS1 was found to be upregulated in tumor tissues compared to non-tumor tissues, suggesting its potential role in tumor development [PMC7109275]. Additionally, high expression of LMO7-AS1 was associated with poor prognosis in patients with CRC [PMC8832759]. In pancreatic normal tissue, the alternative splicing of LMO7-AS1 was regulated by the C allele of rs7985480 [PMC8435735]. In childhood kidney cancer, high expression of LMO7-AS1 correlated with poor survival [PMC8093825]. Furthermore, LMO7-AS1 was identified as a prognostic biomarker associated with shorter overall survival in patients with Wilms tumor (WT) [PMC9452976].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCGGCCGCCCGGCCCGCUUGACAUACCAGAAAUAGCUGCACACAAUUGUACCUUUCCCGGCCAAGAAACCUCCCCCGCUGGGGAGCGCGGCCCGCCGCCCUCACCUGAGCCCCGGCCAGCUGAGCCCGCUACCCGCUCUCCCGCCGCGAUCCGGCCCAGCCGCCAGGCAUAUUCUACCAGUGCAAGAGAUCAACAAUGAUUACAAAAUUGCUAAAGAAGUCACUUUCAAGAGAUCUGGAGAAGUAAGAUGGCCAAAUAAAAGCCUCUACCAAUCAUCCUCCCCACAGGAACACCAAAUUUAAGAACUAUCUACACAAAAAAGCACCUUCAUAAGAACCAAAAAUCAGAGAGAACAAGGAUAAAGAAGUAUCCAAAUACAAAGAAAAUGUUAUGCAAGUGACCUUUAGAGAUGUUUUAAAGAUGACAAAAUAUUGAUGAAGAUGGGCCAACAAGUGUUACUGUUACCUCUAAUAAAGUUUCAUCACUAGUUUCACCAUGGUUAAUUGGAAAUGGCUUCCGCCCAUCUGUGGAAAACAGACAAACAAUUGAAUGCUUAGCUGUUUUUACAGGAUAAUGUGCUUUCAACUUCCAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications