v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-34c precursor URS000075E7C8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR34C: MIR34C is a microRNA that regulates gene expression [PMC4067617]. In a study, it was found that the gene expression of Bcl-2 was highly expressed only in embryos at day 1 after treatment with the VFm34cI, which inhibits the function of MIR34C [PMC4067617]. This suggests that the VFm34cI was successfully delivered into zygotes and effectively inhibited MIR34C function [PMC4067617]. To further investigate the differences in MIR34C expression induced by Zika infection, a real-time PCR (Taqman assay) was conducted on three different clones [PMC6425033].

mRNA interactions 3 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 18 other species

  1. Aotus nancymaae miRNA (ENSANAG00000013118.1)
  2. Cebus imitator microRNA 34c (ENSCCAG00000018216.1)
  3. Gorilla gorilla gorilla microRNA 34c (ENSGGOG00000033730.2)
  4. Ictidomys tridecemlineatus microRNA 34c (ENSSTOG00000025663.1)
  5. Microcebus murinus microRNA 34c (ENSMICG00000018096.3)
  6. Mustela putorius furo (Domestic ferret) miRNA (ENSMPUG00000023600.1)
  7. Octodon degus (Degu) miRNA (ENSODEG00000022698.1)
  8. Otolemur garnettii miRNA (ENSOGAG00000018232.1)
  9. Pan paniscus microRNA 34c (ENSPPAG00000003129.1)
  10. Panthera pardus (leopard) microRNA 34c (ENSPPRG00000013461.1)
  11. Pan troglodytes ptr-mir-34c (ENSPTRG00000027855.2)
  12. Pongo abelii miRNA
  13. Pongo pygmaeus microRNA ppy-mir-34c precursor
  14. Propithecus coquereli miRNA (ENSPCOG00000002145.1)
  15. Pteropus vampyrus (large flying fox) microRNA 34c (ENSPVAG00000027377.1)
  16. Saimiri boliviensis boliviensis (Bolivian squirrel monkey) miRNA (ENSSBOG00000019784.1)
  17. Tupaia belangeri microRNA 34c (ENSTBEG00000017874.1)
 Publications