Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 66 member A (FAM66A) URS000075E73C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM66A: FAM66A is a gene that has been found to have various roles in cancer, including predicting early wake-up-related gene expression in cancer cells [PMC9652512]. It is also involved in the vitamin D receptor signaling pathway, which is important in regulating various cancers [PMC9652512]. In small cell lung cancer (SCLC), FAM66A has been identified as a gene signature that can predict prognosis [PMC9652512]. In the context of lung adenocarcinoma (LUAD), FAM66A and another lncRNA called PSORS1C3 have been found to play a role in distant metastasis [PMC9652512]. FAM66A has also been linked to ovarian carcinosarcoma [PMC9652512]. The transcription differences of lncRNA FAM66A and PSORS1C3 between normal distant metastasis and non-metastasis patients need further validation in cell models [PMC9652512]. Furthermore, both lncRNA FAM66A and PSORS1C3 have been associated with tumor metastasis in LUAD [PMC9652512]. It has also been suggested that FAM66A may be involved in diabetes, along with other genes such as BLK and FDFT1 [PMC9189494].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUGCGCGGUCUGCCUCCCGCGGCGGGCCGGGUCUCCAGGGAGGACCUGAGUUUUCUUCACCCAUUGUCAGGGAGGCGCCAUCGCCCUGGCUUUGGGGCUGGGGCCUCCGGGGAGGUUCCGGUAGGGGCGUUGGAGAGGCCGCUCUUUUUGCAAGGCCCGAGACGGCGGGCCCUGCGCAGGCCGCCCUAUUCCGCGCCCUCAGGGCGUCAGUAUCAGCCUGAGGCUGGAUACCCCCGCUGGGCCCGGAUGACCCCGCUGGGCCCGGAGCAUCCUCCGGCGCUGCCCUCCCAGAGCCACGCAGAGGCUGAGGUGGCGCGGGGGCGGCCCCGGCUCCGCGAGAAGCGGCGGCAGCGAGGGCUGGAGGACCCGGGCUGCGGGGCUCCGGGGCGUCUGGCCUGGGUGGGACUGAGCCCAUCCAGGGACUGGGACUCUGGGAUUCUGGUGUAGGUGGAUCCGGGGCAGGCUCAGGACCAAGUCCCUCUCCUUCCACCAAGGAGCGCCCAGAGGCCGGCGGGAGCUCCAGGUUCACCUCCUCCUCCUCCAGGAAAUCCCACUUCCAGCUAGAUGUCUGCAUGAACUACUGAAAGCUGCUGAGUGUCUUGCAGCAGCUUGACUACCACACAAAUGAAUCCAUUCAAAUGUUGGCAAGUGGAGCAGAGUCCCAGGACAGGUACAGAAACACCCCCAGUUCAAGAAUCUUCACAUCUGAAUUUAGUCCUACACCUGCAACUACCCCAGCUACUUACACCAAGAUGAAGAUAAUUUAUUAGUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications