v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-363 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-363 precursor URS000075E6A6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR363: MIR363, a type of microRNA, has been investigated in the context of prostate cancer (PCa) [PMC10067432]. Research utilizing RIP assays has demonstrated that MIR363, along with miR708 and circEZH2E2/E3, can be identified in immunoprecipitates obtained with anti-Ago2 [PMC10067432]. Additionally, the levels of MIR363 and miR708 were found to be significantly lower in PCa tissue samples and PCa cells (PC3 and DU145) compared to benign prostatic hyperplasia (BPH) [PMC10067432]. These findings suggest a potential involvement of MIR363 in the development or progression of PCa [PMC10067432].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUGAGUAUCAUAGGAGAAAAAUUGCACGGUAUCCAUCUGUAAACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Gorilla gorilla gorilla microRNA 363 (ENSGGOG00000034592.2)
  2. Pan paniscus microRNA 363 (ENSPPAG00000010041.1)
  3. Pan troglodytes microRNA 363 (ENSPTRG00000049107.1)
 2D structure Publications