v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1843 (LINC01843) URS000075E43B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01843: LINC01843 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including lung adenocarcinoma (LUAD) and colon cancer. It has been found to be upregulated in patients and is associated with poor survival in these cancers [PMC9465021]. In a study on ACC, LINC01843 was identified as one of the 24 FerRLs that were independent prognostic factors for the disease [PMC9705333]. In LUAD patients, LINC01843 was one of the nine lncRNAs that significantly correlated with survival [PMC8798323]. Interestingly, LINC01843 was found to be mainly distributed outside the nuclei of LUAD tissues, unlike other lncRNAs [PMC9434379]. Additionally, the expression of LINC01843 was associated with various clinicopathological characteristics in LUAD patients, including pT stage and pN stage [PMC8339970]. References: - [PMC9401518]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9401518/ - [PMC9705333]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9705333/ - [PMC9465021]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9465021/ - [PMC8798323]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8798323/ - [PMC9434379]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9434379/ - [ PMC8339970]: https://www.ncbi.nlm.nih.gov/pmc/articles/ PMC8339970/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UGGGGUCAUUGGGCUGCCUUAGAUUCCCCCCCCCACCUCUCAGCCUGCUGCCUCUGGACAAAGCUCUGCAGAGGAGCCCCAUCUCCUUCAGCCCCCUCCUGCCUUUGGGGUGCAAGUUUCCUGAAGGACUUGAGUGAGAUGUCACCAAGCAACAGGCUGUCAGGCUCUUGGCAGCAAGUACUGGCCCAGCGACUCGCGGCAGAGUCUCUCCUUGGGGCGUCUGUCCUUAUCAGGGGUGGAUGCUGUCAGACUUGCUAAUGGUGGAAUUUCUGGCAUGUGGCAGGGCCAAGUGCAGUGGCUCACACCUAUAAUCCCAGCACUUUGGGAGGCUGAGGCACGAGGAUUGCUUGAGCCCAGGAGUUCAUCACCAGCCUGGGCAAUAUAGCCAGACCCGGUCUCCACAAAAAAAUUUUUAAAAAUUAGCUGGGCAUGGUGGCCUGUGCCUGUAGUCCCAGCUCUUUGGGAGACUGAGGCAGGAGGAUCAACUUGAGCCCAGAAGGUCGAAGCUGCAGUAAGCCAUGGUCAUGCCAGCGGAGUUGAGCCUGGACCACAGAGCAAGACACUAUAGGGAAGACAGCCAGGUGAAAAUGAAGGCAGAGACCAGAGUUAUGCAUCCGAAAGGCAAGGAAUGCCGGGGGCUGCCAGAAGCUGGAAGAGGCAAGGCAGGAUCCCCCACUAAAGGCCUUGGAGGGAGCAUGGCUUUAGCAGCACCUCAAUUUGGGAUGUCUAUUUUCCGGAACAGCGGGAAUAAGUGUCUGCUGCUGUAAGCCACCCUGCCUGUGGCACUUUGUUACAGCAGCCCAGGAACCUGACCCAGCCAGGCUGCUCCUGCUGCCCAGUGUGCCCUUCUCUCAUCCCUCCAGCUGGUCUCUCACUGCCUUCGAGCCCCAUCACCUGCUCGGGCUCCCCCUCUGUGUGUCCCCAGUUCUGGACACUUAUUCAGCAGACCUGUAAGUUUUGCUGGCCAGCCUAUCUCCCUGGCUAGACUGAAGGCUCCUUCAGGGCAGGCCUAACCUGUGCUAGGGCAGCAUGAUGCCUGGUACAGAAUAGGGGCUCCUUAGAUGUGGGGUAAAUAAAGGAAUGCUCGAAGGGUGAUGGGCCCCUGUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications