Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-130b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-130b precursor URS000075E379_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR130B: Importantly, recent studies have documented, while responding to an H. pylori infection, the infiltration of a unique subset of PMN-MDSCs which express MIR130B, an endogenous short noncoding RNA, as well as TNF-α, known to contribute to immunotherapy-resistant gastric cancer [PMC8699100]. Cyld was recently shown to be a bona fide target of MIR130B and that the NFκb subunit p65 was a potential regulator of the MIR130B locus [PMC7377952]. Therefore, we determined whether there is a feedback loop between NFκb activation and MIR130B expression, by using the human myeloid HL-60 cell line [PMC7377952].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCCUGCCCGACACUCUUUCCCUGUUGCACUACUAUAGGCCGCUGGGAAGCAGUGCAAUGAUGAAAGGGCAUCGGUCAGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications