v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) breast cancer anti-estrogen resistance 4 (BCAR4) URS000075E333_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

BCAR4: BCAR4 is a biotin-labeled long non-coding RNA (lncRNA) that has been found to interact with β-catenin in HCT8 and SW480 cells [PMC5696224]. In rectal cancer patients, the expression levels of BCAR4, along with other onco-lncRNAs, were significantly increased compared to the control group [PMC9163174]. BCAR4 has been shown to promote cell proliferation and migration in chondrosarcoma [PMC7848411]. It has also been found that BCAR4 is upstream of GLI2 and may synergize with GLI2 to promote the development of non-small cell lung cancer (NSCLC) [PMC6326698] [PMC7848411]. In gliomagenesis, BCAR4 has been shown to have oncogenic roles [PMC6913310]. Functional assays using BC cell lines have demonstrated the activity of BCAR4 in breast cancer cells [PMC6984777]. Additionally, it has been reported that BCAR4 is closely associated with colorectal cancer (CRC) initiation and dissemination through targeting microRNA (miR)-665/STAT3 signaling [PMC7039150]. Overexpression of BCAR4 in colorectal cancer cells facilitates stemness maintenance, proliferation, and migration of ALDH+ cells [PMC9275979]. In breast cancer, it was found that BCAR4 stimulates the phosphorylation of ERBB2 and ERBB3 along with their downstream regulators AKT and ERK1/2 [PMC7565380]. Furthermore, BCAR4 induces a growth advantage in the presence of various antiestrogens in breast cancer cells [PMC5929455]. It has also been reported that lncRNA BCAR4 serves an important role in CRC development along with other genes and signaling pathways such as RACK1 and lncRNA RP11-317J10.2 [PMC7039150] [PMC8436895]. BCAR4 has been shown to wire up the Hippo pathway effector YAP and Hedgehog signaling to reprogram glucose metabolism in breast cancer [PMC6856575]. In response to the CCL21 chemokine, BCAR4 binds SNIP1 and PNUTS, activating the non-canonical Hedgehog/GLI2 transcriptional program and promoting cell migration [PMC7079433].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUUAGUGCUGGGAAACAGUGCUAAGAAGGAUACAGUGGCUAGAAGUCGUCCUGUCGUCCUGCCUCACAGUAACAUCGUUACCGAAUUCUCAGCAGGUGAACCAAAUGAAAUGGUCAACUGAAAGCCAACCAGGGUAAAACAGAUCUUUUAUUUCUUGUUGUUGUUAUUAUUAUUUUUUUUUAUGUGGGGACAUUCAAGUGAACUGCUAUAUGCAUUUGCCCCCAGUCUCUCCUUGUGAGAAGUGAAUUUCUUCAACGUUUAUAGAACUGAGGUAUUACAUUAUUGGAUGAAUUAAGAAAACAAUCUAACCUGAUGUGUGAAAAUUUCUGCUUGUGAGAAUCCGUGUUAUUUCAAUUAUCCAAUCAAGAGCCUAAUUCGUAUAAAAGAAACACAGCAGCUUGUUGCUCAUCUUUUUAUCUAAGGACGGUUUGUCUUGACAGAGGGUGUCUGGCUGUUUUGGGGAAACUAUUCCUGACCUUAUUUUGACUAAAAAGUUGCCUGCUGUACCAGGGCCUGUGAUGUGUUGAUAAAAUGCCACACAACCAUUUCUCAGUGAAAAGCCCAACCGGGACUUGAGUUAUGUUGGUGGCUAUGGAGUUCUGCAAUCCACAAUUGAUGUUCUCUAAUAACCAGUGACCUUGAGUGAACUGUCCCCAAGGCAAGAGCAACCACAGCUGCGGGGAGCGUUUGGCAAUCACUAUCCCCACCCAAGCUUCUCCCUUGGGUCUUGUCCUGUCACUCUGGCUGGAAUACAAUGGCGUAAUCAUAGCUCACUGCGGCCUCCAUCUCCUGGGUUCAAGUGAUUCUCCUGCUUCAGCUUCCCAAGUAUCUGGGACUACAGGCAUCAAAAAAUCACCAUGUACCAACCUAUCCAAACUUAUCCAUGGAUGAAUCUAUCCAGAAGACGGGAGUUCCGAUGCUUGUCUUGCUCUGAAUGUCUGCUUGUCACCUGCUUAGGGUUAUCGACUGUGAUUCUGGGACUCAUUGUUGUUCUACAGGACCCCUCUGACUCUGUGGUUUUCUCUACUGGAUUAACAAUGAUAGCCAUAGGUGCUUUUUUUGUUGUCCUCACUGGAGUGACAGCCCUGUGUACGGUUACAGUCGACGAGAACUUGCAGAAAACCACGAGGCUAAGACUAGGAGUGAUACGAAAAAGCGGAAGUCUCCAAGGAACUACAGAGCCUUCCAUGACUCACUCAAUAAUCGCUAGCACCUCGCUGUAGUUGUACAUUGAACCCUGGCAUCUUCGUCUUUGGAACUAAGUCUCCUGAGCAUUGUUUUUAAAUAGAAAUAAAAUCUGGCUUUUAAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications